Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1752  (registered. 2012)
Contig Information
Length 933 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_SH - 2
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_VWD Shoot grown with dessication 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125541036|gb|EAY87431.1|| hypothetical protein OsI_08839 [Oryza sativa Indica Group]
Score 254
Evalue 1.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1752
ACGCACTATTCCAGTTCCTACCAAGGCAAAGCATCTGGGGGCCTGAACTTAATTTGGCAAGCATGTGATTTTAGAATTCAACAAACATCCATGAGGAACA
AGTTAATGAAAAGTATGATTCCAGCATGGCTATCCAAATTTATGGTTCTGAGACACATTCGCAAGAACGTTTTGCAGGAACAGTGTTCATGATGATCTTT
ATCGCATAAAGACCTATTTTACTCGAACTAGATCTGAAGCAGGTAAGTGATAACAGAACGCTAGCGAAATCCGGATCGCGATCTCAAACATCCACACTAC
AAAGGAAGAAGAACACGGAACGCATGCATCACAGGTTTGTATCTAGGAACATAAACGCGGGAGAAGACGGAGCAACGGCACCGTCGGCCTGCCGGGGCCG
GGACGCGACGGGGAGGAGGGGATCAGTCGTCGCGCTTCTTGAGCTTGTCGACGCGCTGCTGGAGGTGGTCGAGCTTGACGACGAGGGAGGTGACGGAGAA
GAGGATCCAGTAGAGGAGCAGCGCGGCGGCGATGAGGAGGGCGTTGCGCTGGGACTTCATGATGGACTTCTGGTGGCGGAGGTGCTCGGAGGGGGTGCAG
GCGTGCTCGTCGTCGCAGGTGGGCCGCATCTCGTACTTCCAGTAGATGTCCATGAGCAGGAAGAGGCAGAAGGGCACCACCGACATCATGGGCTTGAGCG
CGCTCCGCACCACGGAGATCATCCCGCGCCGGAGCGCGTCGAGGCCCGGGAGGGTCAGCAGCAGCAGCATGATGGCCTCCGCGCCCGCCGCGTACCCCAG
CACCACCCACTCCAGCGCCATCGCGGCCGGATCTCGCGCCTTCCGATTCGCCGGAGATCGCTTTGCTTGGGAGAGGGGATTTGGAAGGGGGGTGGGGAAA
ACTCTGGTGGGCGTGCGTGCGTGTGCGCCGGGG
page-top