Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17508  (registered. 2012)
Contig Information
Length 1207 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108925894|gb|ABG23315.1|| vacuolar proton-ATPase D subunit [Triticum aestivum]
Score 569
Evalue 2.00E-160
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17508
TTTTTTTTTTGTCCTTTCTAAGCTGCACAAGTTCCATTTGATAATGCAGTAAAAAAGAGTTTGTTTTGCCAACAAACCATTTGATATCTTGGGTGTACAT
TTTACATTGCCAACAAACTGCACAAATAGTGCCACCCACTACGAAAATAAACATCATTTATTTAGTTTACCGTACAACTGCGCCTTTTATTTTACTACAA
AAACAAATAATGATACACTAGTCCAGGTCTAGCTTTTCAGCCGCATAGAAAGAGGAACAGGGGTAATAACAAATCATGAGCTTGTAAAGTGTGCAATCGA
TTGTGCCATCATCAAAGCAGACCTTTTGCACAACCATATGCACAGTAATAGGGGGCGATTAAAAGATCGGCACAACGCTGTCGTGGACCCTGTTCTTCTG
GTTCTGGGCAACGCATTCCGAGATCCACATCAAGTTCCTTATCTCCTGCTCTCGTAGCCTCATGTATGCGAAGAAAACAGCGTAGTGGAACTGCTGTTCA
AATGACTGGCACAGCCTCTTTACTTCCTCCTCATAAAAGGCCTTGTCCAACATCTGGCTTTCGCCATATGATATCTTGGCAAAAATAGACTGGTATGGGG
GGTACTTTTCCATTACACCACGCACCTGGTCAACATCTTCACAGACAGCCAACTCTTCATGACCATACGGAAACAATAGACCAAAGTTGGAGTACAGCTT
CCGGCGGTCATCTCTAGTCAGCTCAGTACCAATACTGTTTATGGTAATGTTTACAGCTCTTCTGTCAGCTTCAAATGAAAGGAGATTACACATAATCTCA
GCCGTCGCACCACCTAGTTTCGCACAAAATTTGTAAAAATCCTCAAGATACGCTTTGTAGAGTGTGTTCCTCATGATCTCAATATTCATGTCATCCAGAT
CCTCAGATGTAATGCACTCTGAGAAGTACGGTGCTAAGGGTGTATCAACTAGAACCAGCCTGTAAAGCTCACGCATATTTTGAGCAACCGCAAGTGATGC
AATGCTGTCAAACATGCCCAATGGATGGCATTTCTCCAACAGTTCGTTAACATCTCTTTCATGCAATGTCCCAGTAACAATAAGGACAACATTATCGATC
ATGTGTCCATATGTTATGTACTGTAGGAATGTAGATAGAGGTTCATTCGCCTGGCACAACATGTGTTTGTATTCATCAACCAGCTTAAGAGTGCACTTCT
CCACAAT
page-top