Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17444  (registered. 2012)
Contig Information
Length 1126 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|289188050|gb|ADC92550.1|| UDP-glucosyltransferase HvUGT13248 [Hordeum vulgare subsp. vulgare]
Score 583
Evalue 1.00E-164
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17444
TTTTTTTAAATAATAGCTTTATTATTGCATCTAGGGCATATTTCCTTCATGAAGAAGATATCACTACAATTACATATGGAAAATGTCGGCCACTCTAAAC
TTTTGTAAGGCTGAAATCACTGCCTACTTGCTTATATTGAAGTAAAACATTGTTCAAACTTTATATTGATGAATACTTGGTAGCGAATTCTATGATATTC
TTGTCTGAACTTCCTCCTTCCCGCATTGCCTCCTTGGCCTTTTGCATCCACTTCACAACATTTCTTTTGTACTCATCCTTTCTCTCCACATCCATCACCT
CTCTAATGCACCTCTCAAGCTCCTCCATCTTTAGATATCCATTATTGTCCTTCGGTACACGCACACCCATGCTCCATGCACTCTCCATATACTTTGCAAT
GGTGGGTTGGTCAGCCCAATGCGGAATACCCACAAGAGGTACACCATTAACAAGTGCCTCTAGTGTCGAGTTCCATCCACAGTGGGTAACAAAGCAAGCA
ATAGCCCTATGTGCAAGAACCTCAAGTTGGGGGCACCATGAGACAATTAATCCAATCTTCTCACATTTTTCCTTGAGTTCTTTGGATAACTTGTGTTCCT
CGTTGGACCTTACAACCCAGAGAAAAGGTTTACCGGAATTGCACAGTCCATTGCCAAGCTCCTCTAGCTGGGTTGCATCATAATTAGAGACAGTCCCATA
GGACACCAGCACAACGGATGAATTGCTTTGCTTCTCTAGCCAATCCATGCACAGTGCATCACCGTTGAAAAAGTTAAAACCATATGATTTATTGGATGGT
AGGCGATCATCGTTGAGGTAGAATGATGGCAAGGTTGGGCCAACCATCTTCGCTCTCCATGTTAATTCCATGTACTCTACCTCCTTCGGCTCGAGGTCGC
GGAATGAGTTGACGAGCACATCGTCGGCGTCCTCCAGCCCCTCGAACTGCCCAACCGACACCTTGAGGAACGTTGGCTGCGACTCCGGCACCGCCGCGAA
CGGCGGCATGTCCTCCAGCCCCAGCTCCACGCCGAGCGCTCCTCTCGCGAGCAGCGCGCGCCCGTCCGTCGCCGGCAGCGCCAGCCGCCCCGCCCACAGC
TCCCCGTAGACGACGTCCACCGCGCA
page-top