Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17433  (registered. 2012)
Contig Information
Length 1193 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242046272|ref|XP_002461007.1|| hypothetical protein SORBIDRAFT_02g039095 [Sorghum bicolor]
Score 371
Evalue 8.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17433
CAGAGTGATACCACTGCAGTCACTAGATGGGACGGACGAATAAGAAGGTGAACATTATAGAGTCTGTACAGCACCCCCAGCTAACTAAATGGGGGTGGAA
ACCAACCACAGCAGCTCGACAAAATTTGGTACACGACAACAGGCGGTGCGACAACTTCTGTCAGGAAAAACACAGCCCACACGTACACCTCTTTCTATCC
CGGATATTTAGCTCACTGAGATTACCTTACAAAATTTCAAGCCCGGGTAGGAGAACAAACAACCAATTCACTCTGGTGAGAAGTCTCCAAACGAATAAAT
GGAACCCTGTTGTATTTTTTTTTCTCTCATGACAAACTCTTGGGTTATACTTCCATGCATCCGATGACATGCGGTGAACAGTCAACTTCGCCACGGCAGC
CATATAGTCTGTAAAAATGTTCCCGCAGTATACATCTTCTAATCTCNNNAATGGTAGCTTTATATACATCACTGATACAACTACCCTATACTCAAATCAT
ACAGCTGAGGAGTCTTCTGGCAAACAGATTGAAAATGAATAGAAAGATGCTATCTGAACACAAGACTCCCATTCTGCTGTTGTCTTATTTTCTCGATAAG
TGATTGATAAAATGACCTGAATGCCTTTATGTCGTTTCCCTGTAACTTTTGGTAGTACTGTTCAGCTAGCTCTGGTGGGCAGTGAGCTTCTGGAAGAGCT
TTTGCTACAAAATTTACAATGAAGTCCTCCCCAAATCTTTCATACATAACCTTCTGAGCCATCACAATTTCACCAAAGACAACAAGCGTATTTGCATCAC
GTAAATCAAATGATTTTTCAAGGACACTGTATAAACAGCAACCAGTAGCAAACTTCTCAATCATGAATACTCGGAAGCCAGGAAGCTTATCATCAGCTTT
GGATGTAGTGCACCAGTCTTTTATAAGTTTGACAAAAATCTGCACACACGCCTTCCGGAGCAGTATATCTTTATGACTGCATGAAGTAAACAAAAGTAGC
TGCATTATGGTTTCCAAATACTGCCTACAGGTAGGAGCAAGGAGAACTGCAGACAAATCATGTGTAACCATCCCATGGAGGAATGTGTATAATGTCCTCT
GCAGCTCTTGCAGTTCACGCATTTCCTCGGTATTGCCTGCAGGACCAGTAGAAAAGGCATCTTGTGACAATATCACAGACATACGACTTGCAA
page-top