Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17425  (registered. 2012)
Contig Information
Length 1419 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 5
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 6
Wh_OKCS Seed DPA5 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|30385246|gb|AAP23942.1|| caffeic acid O-methyltransferase [Triticum aestivum]
Score 717
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17425
TACAGAGGAAGATCAATAACACTTCACTTCATATACTCTTCCTATAATCAACAAAGGAGAGAAATCATGTCATTGCATCACATGCAACCTTTAAGAGCAG
CACTATTAATAGTACAGTACATTTCGAATGGGTAGATCGACGGCACAACCAGTAGCATTCAGAATGATTCAGAGCTAGGATGACAAAATTAGGAAAACAG
AGGAAACAGCAAGCCAAAGTACATATTCAGCAGCGCCAGCGAGGAAGAAGAAGATGGTCTCAAAGCGAGCGGTGGACGGTTGGCATGGATCTACTTGGTG
AACTCGATGGCAAATGCGTTGGCGTAGATGTAGGTGGTCTTGATGGCTTTGAAGCCGGCGCCCTTGGCCAGGGCCTCGAACTCCCTCTCGTACCTCTCCC
TGCCGCCGGGGTTGTGCGCGAGCATGATCATGTCGACGTGGAATACCCCCTGCGCCTTGGGCGTGGCCTCCGGGTTCACCGGCAGGATGCACTCCACGAG
CACCACCTTGCCGTGCGCCGGCAGCGCGTCGTAGCAGTTCTTGAGCAGCGTCGCGCAGTGCTCGTCGCTCCAGTCGTGGAGGATCCACTTCATGAGGATG
GCGTCGCCCGAGGGCACCTTCTGGAACATGTCGCCGCCGACGTGGGTGACGCCCGGGAACGGTGGCGCCTCGGAGATGACGTGGGGGAGGTCGAAGTTGA
TGCCCTTGATGGCCGGGTAGGCGGCGACGATGGCGCCCACGGTGGCGCCCACGCCGCCGCCCACGTCGACGATGGTGCCGAGGCCCTCGAAGCCCTTGTA
GACCTCGAGGAGCTTCTTGGTGATGATGATGGAGTGGTTCTTCATCCCCTCGTTGAAGACGCGGTTGAAGCGCGGGTCCGTGCCGTGGTACTCGAACGCC
GACATCCCGTACGCCTTGTTGAACGGGATGCCGCCGTCAAGGACCGCATCCTTCAGGTAGTACCAGCTCTCCATGAGGACCTTGTCCTGGTTCATGAGCG
CGAGCGCTGCCATGGAGACGCCGTCCTCGTTGGGGGTCAGGAACTTGCACACGGGCGCGGCGCTGTACCGCCGGGACAGGCGGCCGTCCTTGCCCTCCTC
CATCGTGCAGGACACCACGTTGTACGAGGCCAGCAGCCGGAGCATGCGGTCCACCATGTCGGCCGCGGCAGGATTCGCCGTGGACGGGAGCTTGGCAGCC
ACCTCGGCGGGGGTCAGCAGCTTGCCGCCGGCGGCCACCAGGGTCTCGAGGAGGCCCAGCTCGATGGCGTTCTTGAGCGTCATCGGGAGGATCGACGACG
AGACGAGCTGGAGAGCGTACATGCACGCCTCCTCGTCGGCGGAGGCGGCCATGTCGGCTGCGGTGGAGCCCATCTCTGCCTCTCCGGAGCCGAGCTGCTG
CTGCTGCTGGTGGTTGTTT
page-top