Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17360  (registered. 2012)
Contig Information
Length 1152 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|24496452|gb|AAN59956.1|| actin [Hordeum vulgare]
Score 471
Evalue 6.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17360
TGAAGGCCTTATAAACCAGTGATGAACCGTTGATAATCGCATGGAAAATGGTCCATGGATGACCACTGTATAACGCCTTGAGATCTTAAAAAATCCATAA
TTTACCATGATCCTCCCCTCAAAGAAATAATAAAGATATAGTACATAGCAAAAACCATGAGCTATTACAGACAACTCCAACAACAAATCAAGCCAACCCA
AGTTTGACAACTGATCTCACAAACATACTGTGACAATGCACAAACATAGATATAGTGTACTTGCACTTGCACTTGCACCATGGAGCCGCCACGTATATAG
GCGGCATATCCCGAGAGTACTCACGTCACGTCTGGAAAAAAAACATAGCTTGCAAATACGCAATACATTTCTAGAAGAATGAACCAAACATAACCCGAGA
CTAGATGATAACGGCGGCGCAGCGTTTCGTGGAGATCAGAAGCACTTCCTGTGGACGATCGCCGGGCCAGACTCGTCATACTCGTCCTTGGATATCCACA
TCTGTTGGAAAGTGCTGAGTGAGGCTAGGATGGACCCTCCGATCCAGACACTATACTTCCTCTCAGGTGGAGCGACGACCTTGATCTTCATGCTGCTCGG
GGCAAGGGCGGTGATCTCCTTGCTCATACGGTCAGCGATACCTGGGAACATGGTTGTGCCACCACTGAGCACAATGTTGCCATACAAGTCCTTCCTGATA
TCCACGTCACACTTCATGATGGAGTTGTAGGTCGTCTCATGGATTCCAGAAGACTCCATGCCAATCATGGATGGCTGGAAGAGGACCTCAGGGCACCTGA
ACCTCTCTGCGCCAATCGTGATCACCTGACCATCAGGAAGCTCGTAGCTCTTCTCAACCGAGGAGCTGTTCTTGGCAGTCTCCAGCTCCTGCTCATAATC
AAGGGCTACGTACGCAAGCTTCTCCTTGATGTCCCTTACAATTTCCCGCTCGGCTGAGGTTGTGAAGGAGTAACCTCTCTCGGTGAGGATCTTCATAAGG
GAGTCAGTGAGATCCCGACCAGCGAGATCCAAACGAAGAATGGCATGAGGAAGCGCGTATCCTTCGTAAATGGGCACAGTGTGGCTGACACCATCACCAG
AGTCGAGAACAATACCGGTAGTACGACCACTTGCATAGAGGGAAAGCACGGC
page-top