Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1735  (registered. 2012)
Contig Information
Length 1625 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081045|ref|XP_002445291.1|| hypothetical protein SORBIDRAFT_07g007870 [Sorghum bicolor]
Score 785
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1735
CCTATGGCCGAGGAGCAGCAGCTGCAATGGAGGACAGTACTATTGACTTTGGTGACTTCTTCAAGGGCCCTCTGCCCGGGAAGTTTCTGAAGCTCCTTGG
GTTTTTGGCATTGTCTCGACTTGGTGTGTATATACCTTTGGGTGGAGTGAACCAAGCAGCTTTTGCTGGTAATCTTGACCAGAACAGTTTGCTGGGCACT
TTAGATTCTTTTTCTGGTGGAGGTATTGGCCGGCTTGGTATATGCTCCCTCGGCATTGTTCCGTTCATCAATGCACAGATTGTGTTTCAGCTCCTTACTC
AGCTTTACCCAAAATTGCAAGAGCTTCAGAAAAAAGAAGGGGAGGCAGGTAGAAAAAAGATTCTTCAGTACACAAGATATGCATCTGTTGGTTTTGCAAT
TGCCCAGGCTATCGGGCAAGTTCTTTTTCTTCGTCCTTATGTTAATGACTTCAGCACAGAATGGGTACTAACATCTGTGACTCTATTGACGCTTGGATCG
GTGTTCACAACTTTCCTTGGTGAAACAATATCTGAGTTGAAACTCGGGAATGGAACATCTCTTCTTATCTTTACAAGTATAATATCGTATTTGCCTGCAT
CATTTGGAAGGACAGTTGCAGAGGGATTTCAAGCAGGCAATTATGTTGGACTTCTCACAATCATATTGTCATTCTTTTTCTTGGTTCTTGGGATTGTCTA
TGTCCAGGAAGCTGAGAGAAAAATACCACTGAACTATGCTTCTCGATACGGCAGTCGAACTGGAGGACCCCAACGTTCTGCATATCTACCTTTTAAGGTC
AATAGTTCCGGTGTCATGCCTATCATATTTTCTACGTCTTCGTTGGCTTTACCTGCTACTTTGGCACGTTTCACTGGCTTAGATTTTCTTAAAAAGGCTG
CCATAGCCCTAACTCCAGGAGGTTCTTTTTATCTTCCAACTAATGTATTGCTTATAGCCTTTTTCAATTACTATTACACTTTTCTTCAATTGGATCCTGA
TGATCTTAGTGAGCAATTGAAGCGAACAGGTGCGTCAATACCGCTTGTGCGGCCAGGAAAAAATACAGCTGCCTTTATTAAAACAGTTCTTAGTCGTATC
TCTGTCCTAGGATCTGCCTTTCTCGCTGTACTAGCTGCTGGACCATCTGTGGTTGAACAAATCTCTCACTTGACAGCATTTCGGGGATTCGCTGGTACAT
CAGTGCTTATCCTTGTTGGATGTGCAACCGACACGGCTCGGAAAGTTCAGACAGAAATAATTTCTCAGAAATATAAGGACATCGAGTTCTATGATGTCAA
AAGTTCTGACAAATGATTATCTTCCGAACATGTACTTAAATATAATCTCGTATAAATGATTGTTGTGTCATTTGGTAGTACTATTTCATTATTCTTTTCC
TTTTTTTCTCTTCTGTGTATATCAGTTAGATCTTTTCTAGAGGATCAGAGTTCGGAAAGCATCAGTATGTAAAAGATACTCTATAGCTGTGGAAGCTTTA
CAGCTCATGGATATTTCTGTTGTGGAGTGATCTGATGTGATCTCTGTACCCTGGAGAAGGGATTTTAAACTTTATGTATATTGCTTCTTAAATTTTAGAA
CTAAAGTATTGGAGAGTGTTCAACA
page-top