Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1734  (registered. 2012)
Contig Information
Length 1127 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115465043|ref|NP_001056121.1|| Os05g0529300 [Oryza sativa (japonica cultivar-group)]
Score 412
Evalue 3.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1734
GAATTCGGCACGAGGCGGACACAGAGCACGCCGCACCTCCCCCCTTCCCGTCCCTTCCATCGCCACGCCTCGCGTCCCCTCCGCCATTCCCCCGCCGCAT
CTGGAGCGAGCTCCCACCGAATAAACCCCCAAAACCTAGTCGCCGCCGTCGCCGTCGCCGGCGCCGCCGCAGCAGCCATGAACGCCTTCCGGTTCCTCGG
GGACATGACCCACCTCTTCTCGGTCATCGTCCTCCTCCTCAAGATCTACGCCAACAAGTCATGCTCAGGGGTGTCGAGGAAGACGCAGGAGCTGTACCTG
GCGGTGTTCGTGGCGCGGTACCTCGACCTCTTCACAGACTACATCTCGCTCTACAACTCCGTCATGAAGATCGTCTTCATCACCACCTCCGCCGCCATCG
TCTGGTACATGCGCCGCCACCCGCAGGTGCGCCGCACCTACGACCGGGACCAGGACACCTTCCGCCACGTCTTCCTCGTCGCCGCCGCCTTCGCGCTCGC
CCTCATCTTCAACGAGCGCTTCACCCTCCGCGAGATATGCTGGGCATTTTCGATTTACCTGGAGGCAGTGGCGATTCTACCTCAGTTAGTTCTGCTCCAG
AGAAGCAGAAATGTGGATAACTTGACTGGACAATATGTTCTGTTTCTCGGGGCCTACCGCGCATTCTACATTCTAAACTGGATCTACCGTTATTTCACAG
AGGGTCACCAAAGCAGATGGATCCCTTGGATTGCTGGTTTGGTCCAAACTGGTCTATACGCAGATTTCTTCTACTACTATTTCTTGAGTTGGAAGAACAA
CGTGAAGCTCGAGCTGCCTGCCTGAGCATGCTTTGTCCATGCGACAAAAAGCACACATTGCATTGCATGGGCCAGAAGTGTTGTCCAGATTGAGTTGATG
ATATTGGCATGAAGAGACTCGGTGGTCCTAGTGGATTATCTTGGCAAAAAGCTATATTACGTTTGAGATGCTAACAGTACACTAGTAGACTAGTTCCATT
TTGTACCTGGGATGGAGAATCAGCGAATCCAAATTCATTTGGCCTGTCGTTTGCCCGCTCTGTTTCACCTGCTGTAAACAAACAAACGATGCGATCTCCA
GTGGTCTTGCCCGCGCTAAAAAAAAAA
page-top