Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1733  (registered. 2012)
Contig Information
Length 694 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|556673|emb|CAA82945.1|| heat-shock protein [Secale cereale]
Score 450
Evalue 5.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1733
GGTTGTATGTCAAGAGGGTTTTCATTTCTGATGACTTTGATGGCGAGCTGTTCCCCAGGTACTTGAGCTTTGTCAAAGGTGTTGTTGACTCGAATGATCT
CCCTCTGAATGTTTCTCGTGAGATTCTTCAAGAAAGTCGTATTGTCAGGATCATGCGCAAGAGACTTGTTAGGAAGACTTTTGATATGATTCAGGATATT
GCTGACAAGGATAACAAGGAGGACTACAAGAAATTTTGGGAGAGCTTTGGCAAATTTATGAAACTTGGTTGCATTGAGGACTCAGGAAATCAGAAGCGCC
TTGCTCCTTTGCTGCGGTTTTATTCCTCTAAAAATGAAACGGATTTGATAAGTCTCGATCAGTATGTGGAGAATATGCCCGAGACCCAAAAGGCTATCTA
TTATATTGCCACAGATAGTCTTCAGAGTGCAAAGACCGCTCCATTCTTGGAAAAGCTGCTTCAGAAAGATATTGAAGTTCTATACCTTATCGAACCGATT
GATGAGGTAGCTATTCAGAATCTGCAGACGTACAAAGAGAAAAAGTTTGTTGATATCAGCAAGGAAGACCTAGAATTGGGCGATGAGGATGAGGACAAGG
AAGAAACCAAGCAGGAATACACTCTTCTTTGTGACTGGATAAAGCAGCAGCTGGGTGACAAAGTTGCCAAGGTCCAAATTTCAAAGCGACTCAG
page-top