Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1732  (registered. 2012)
Contig Information
Length 714 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453279|ref|NP_001050240.1|| Os03g0381200 [Oryza sativa (japonica cultivar-group)]
Score 372
Evalue 3.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1732
TTCGGCACGAGGGGAGGCTACATGGAGGCGGCGATGGATCTGATGCGGCGGATGCCGCCGGGGAGCACCGAGACGGCGCTCAACGCGCTGCTCTCCCTCC
TCCCCGACCACTCCCTCGACCTCCTCTCCCAGGTCGACCTCCGGCTCCAGGTTTGCATGGATAAGGAGAACAATAAGGAATACATTCTTTGCGAGTATAA
CCGCGACACCGATTCCTATCGATCACCTTGGTCAAACATATATGAGCCTCCTTTAGAAGATGGGACAGTTCCCTCAGAAGAGATGAGGAATCTTGAAGTC
GAGGCAAATGAGGTTTTCTCTGTCTATCGTGATCAGTACTATGAAGGTGGGATCTCATCTGTGTACATTTGGGAGGATGAAGACGAGAGTTTCATTGCAT
GCTTCTTAATAAAGAAAGATGGACAAGGGAAAAGAAGTTATATGCAAATAGGTTCGTGGGATGCTATTCATGTTATCCAGGTTGGTCCTGAAGAGGAAGG
AGCAGCACATTACTGCTTGAACAGCACTGTTATGCTGTCATTGACAACAGATAACAAGCAATCGGGAACTTTCAACTTGTCCGGATCAATTAGGCGGCAG
GTTATCCATTCCTCCCTCTTCATATCAACGGAAGGTGCTATGTGAGATATATGCATGTCTTGCATCGCCGCTTTCCACAACTGTTGATGTGTGTATTAAC
AGAACAGATTCGAT
page-top