Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17303  (registered. 2012)
Contig Information
Length 659 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XA Root 4
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400883|gb|AAP80673.1|AF479054_1|AF479054_1 cytochrome reductase [Triticum aestivum]
Score 184
Evalue 6.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17303
CTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCATAAACGATGC
CGGCCACCACCCACCCCATCCCTGAGTTTGATCGGAGCCGGAGGAGAGCATCCACACCGAGGAAGAAGGAGAAGCGGCGAGGCGAGGCGAAAGATGGGGA
AGATGCCGGTGCGGATGAAGGCGGTGGTGTACGCGCTGTCGCCGTTCCAGCAGCAGGTGATGCCGGGCCTGTGGAAGGACATCACCACCAAGATCCACCA
CAAGGTCTCCGAGAACTGGATCTCCGCCACGCTCCTCATCACCCCCGTCGTCGGCACCTACCAGTATGCGATGTGGTACAAGGAGCAGGAGAAGCTGTCC
CACAGATACTAAAGGTGGAGCTTTCTCCAATATCGCAGCAGTTGGAATTTCCATGTTCTATAATCCACCAAGAGTGATTTAACATTTTCGGAATCACTTC
TAGTTGTACTCTTTTGCTCTTTCCGTTGCATATGCAATGATGCAGTAAGTGTGACTTGCAAACCTATTTTGAGGCCTCAAATGTTGAGTTGTCCATCACT
GGAGTGATTTTGTGCAATAAAGCAAATTAACCAGTCATTTTAAAAAGTTAAAAAAAAAA
page-top