Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17258  (registered. 2012)
Contig Information
Length 606 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452085|ref|NP_001049643.1|| Os03g0264700 [Oryza sativa (japonica cultivar-group)]
Score 252
Evalue 2.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17258
TGTAGAGGCAAGAATGTAATGTTACCACATCAAATTTTGGAAGAATGGAACACAAGAAGAGCCATATTTTCAGAACTGAATTTATGTCTGAACTGAAAAA
AAGAGAGCATGAACGTCATCCTGTATACAAGGGGGAAACTGCTATGCCAGAGAGATAGCACCGGCTAGGCGGGAACTCTCCCACACTTCCACAACTGGCA
TGTCTTCTCTGGTCACAAATAAGCGGTCTCCGCCGCCTTCCATCATCTCTATCATTCCACGCTTAGAATCCTCTTCCGTATCCACATAGCTGCTTCTGAA
ACTATTTTCATTAATTCCTTTTCTGTCAAGTGTCTCCTTTGCTCCCCGTTGCTCCGGCAAGTTGCATGTGTCATCTCGTTGTTCTTCCAGTCTGGACCAA
ACCTCCAATCCATCCTTCCGGCTGACAAACACCTGGGACTTATAGCAATGCAGAACACTGCCATGACCCCCTCCACTCCCCTTTGGTCCTGATGACATGT
ACACCCAAGGGTCGTTATCGAGCCGCCTCAGGTCTGCAGCTCCAATATCTCCTGATTTTGAGCACACCTTGTAGAGCATCAGCTGCTTCACGTCCACGTC
TGCATC
page-top