Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17256  (registered. 2012)
Contig Information
Length 855 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125543215|gb|EAY89354.1|| hypothetical protein OsI_10858 [Oryza sativa Indica Group]
Score 489
Evalue 1.00E-136
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17256
GCCCCTCCTCGGCTTCTCCGCGTCCCTCGCATCCACCCTGTCCCCCGCCTCCGAGCCCTTCCCCACCGCCCTCGCCGCGCACCACGACGGCTCCCTCTGC
CTTGCCCACGGCGCCGGCCAGCTCACCTACTACTCCCCGGCGCTGGACCGTCTCACCACCTTCCGTACCCACCACCACCGCGCCACCTCCATCAGGCTGC
TGCCCTCCAGCCTCGCCGTTGTCGGGTCCAGCTCCTCCCCCGGGCTCCATGTGTACGACCTCCTCGAAGGCTGGCACGTCGCCTCCGTTGAATGGTCAGA
CCCGACCGACCTACGCGTCCTCAAAGCAAAGGTCATCGCCATCGCCGCCCGTCCTCCTGCTGACGCCACTGACACAAATTCACCGATCCTCGCTACATTC
GAGTGCCCACACCGGGAGAACTGCATCCTGGCGATTGACCCTGTAACTCTGAAGCCCATACAGGAGATTGGCCGGCAAAGTGGGAGTGCGGCTAAGTCAT
CTTCGCCGGATCGACTAGTGCACCTGCAGGAGCTTGGGCTGGTGTTTGCTTCATCTGTGAGCTCGGGCGCATTTGGCTATTCTGGATACATGAGGCTGTG
GGACATTCGATCTGGGAATGTGGTCTGGGAGACAAGCGAGCCAGGGGGATCCGGAAGAAGCAGCAGGTTTGGAGATCCATTTTCAGATGCAGACGTGGAC
GTGAAGCAGCTGATGCTCTACAAGGTGTGCTCAAAATCAGGAGATATTGGAGCTGCAGACCTGAGGCGGCTCGATAACGACCCTTGGGTGTACATGTCAT
CAGNNNNNNNNGGGAGTGGAGGGGGTCATGGCAGTGTTCTGCATTGCTATAAGTC
page-top