Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17254  (registered. 2012)
Contig Information
Length 880 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|284519772|gb|ADB92638.1|| putative histone acetyltransferase MYST [Hordeum vulgare]
Score 435
Evalue 3.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17254
TACAGATGTGGAACTCTATCAATGTTTGAGGTTGATGGCAAGAAGAATAAGGTTTATGGACAGAACCTTTGCTATCTGGCCAAGCTATTCCTTGATCACA
AAACACTCTACTACGATGTGGATTTGTTCTTGTTCTATATCCTGTGTGAATGTGATGACCGGGGATGCCATATGGTGGGATATTTCTCCAAGGAGAAGCA
CTCTGAGGAAGCTTATAATTTGGCCTGCATTCTCACTCTCCCTCCATACCAAAGAAAGGGTTATGGAAAGTTCTTGATTGCTTTCTCTTATGAGCTTTCT
AAAAAGGAAGGTAAAGTGGGAACACCGGAGCGTCCTCTCTCAGATCTTGGTCTGCTCAGTTATAGAGGCTATTGGACTAGAGTACTTCTGGAAATTTTGA
AGAAACATAAGAGCAACATATCTATTAAGGAGCTGAGCGACATGACGGCAATCAAAGCGGACGACATCTTGAGCACGCTGCAGAGCCTGGACCTGATCCA
GTACCGGAAAGGGCAGCACGTCATCTGCGCAGACCCAAAGGTCCTCGACCGCCACCTCAAGGCCGCGGGGCGGGGGGGCCTCGACGTCGACGTTAGCAAG
CTGATCTGGACACCGTACAAAGAGCAAGGCTAAGCAAAGCACATCTGCCACTCGGCCATGCCATGTCGAATTAGATAAGCTGACCAATCGAGTCGTGTAT
ATTTTAGGAACTCCTTCCCCGTCCCTCGTGCAGTGACTCTACTAGTCTCTTTTTTCCGAACTGTGACTGTAGTGGTCTTGTGTAACATCAGATTGTTGCG
TCTCTCTGCACATTGTTTGCCAAGCTTTCCTATTTATAACTATGTCACCTGTACTGTATTTGTGGTCTTCCTGCTCGTAT
page-top