Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17253  (registered. 2012)
Contig Information
Length 732 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 15
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VHS Shoot with heat shock treatment 5
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657857|gb|AAB18208.1|| cold acclimation protein WCOR615 [Triticum aestivum]
Score 332
Evalue 2.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17253
GATGAGAATTAGCAAATCTGTATATTCAAAGCATCTTTGCATACACTGGACGAAGTTACACCGACGCATGCGTAGAAATCAGTTTCTTGGAACCGAAAAT
AAAGCAACACGGAGGGAATAACGAAACGAAAAGAGGGCTATGATCCTTCGCGGTCTTCATTTGGCGGTGCCGGCGTCGGCTTTGTCTCCTCCCATCCCGA
GCGTGTTCATGACGGCGTCCTTGGCGCCCGTAGCGGCACCCATCACCTGCCCGCCGGCCTGCTGGAACATGTTGCCGGTGGGCTCCTTGGGGGCGACGGG
TTCCCCGGTGAACTTCGCCGCGGTCTCCTCGACGCATTTCGCGGCCTCGGCGGACTTCTGCTTGGCGGCGTCGCCGGTGTCGGCGGCCATCTTCTTGGCG
GCCTCGGTCTTCTCGCCGAAGAAGCCGAACGTCTGGTCCTTGCTCTCGATGGCGCGGTCCGTGATGGCCTGCCCCGTCTCGGAGGCCTTCCCCATGGCGT
CGCCGCCCATCTTCATGGCCGCCTCGGCGGTGTCAGAGGCCGCCTTGGTGACGGCCTCGCTTTTCTCGCCGATGAAGCTGATGGTCTGGTCTTTGGCCTC
GATGGCGCGGTCCTGGACGGACGGCCCCGTCTTGGCGGCCTCGTCGGCCTTGGCGTCCGTCTTCCCCCCGAACCAACCCGACATTTTTGAAGGTGATAAA
GCGTAGTACGTACGTGGTGGTTTGTTGGAGAG
page-top