Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17251  (registered. 2012)
Contig Information
Length 568 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125556679|gb|EAZ02285.1|| hypothetical protein OsI_24385 [Oryza sativa Indica Group]
Score 234
Evalue 5.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17251
TAACAGAAGAGAACAAGTTCTCAAAGCAAAGAAGGCTGGAGAGGATGCGCTGAGAAGGTCAGGCCTTGGATACACAATTGTACGGCCTGGTCCACTGCAG
GAAGAACCTGGCGGTCAGCGTGCACTGATCTTTGATCAAGGAAACAGAATCTCTCAGGCTATCAGCTGTGCGGATGTAGCAGATATCTGTGTCAAAGCAT
TGCATGATTCCACGGCGAGAAACAAAAGTTTTGATGTATGCTACGAGTATGTTTCTGAGCAAGGGAATGAACTGTATGAACTTGTGGCTCATTTGCCAGA
TAAGGCTAACAACTATCTTACACCGGCACTATCAGTTCTAGAGAAAAACACCTAATTCAGATTTGTGTCATATACGGGTCGTAATGTGTATACTCTTCCT
CCTGTAAAGTTACATGTTTTCCTCATAGAAGCCTTATGGAATTCACACGACAAGCCCTTTTTTCTTGTAAAGATCATCGATGGGATCACTTCACAGAACA
AATTCGGCCACTGTAATGGTATATTCTCTTGTTTCTACTCTTTCTCCTCTGAGAATGTAAGCTTGTAG
page-top