Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17250  (registered. 2012)
Contig Information
Length 762 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90289614|gb|ABD92939.1|| alpha tubulin-5D [Triticum aestivum]
Score 340
Evalue 7.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17250
AACTCTTCGTTCATTATTATGATGTATCGATACCACCTTCCTCACAGACGAGCAACACTACACATACGTAGACTTACGTTGAGTTTTACGTAAACCTCCA
CTTGGCAAATTCTGATGGCACCGAACCGTCTGAGCACACGAACCAATTTGACAATTTTTGTACTCTGCTAACCACCGAACATCACAGATGCAACAGCAAA
ACAGGGACAGAGAAGAACAAACCGCATGAAGTGCACAACACTGCCACCAAATAAGAGCGCACACTTGATCCACTCAGTACTCATCGCCTTCGTCCTCGTC
GTCTTCACCCTCAGCTCCGACCTCCTCGTAGTCCTTCTCCAGCGCGGCCAGGTCCTCCCTGGCCTCCGAGAACTCCCCCTCCTCCATCCCTTCCCCGACG
TACCAGTGCACGAACGCGCGCTTGGCGTACATGAGGTCGAACTTGCGGTCGATGCGCGAGAAGACCTCGGCCACGGCCGTGTTGTTGCTGATCATGCACA
CCGCCCGCCGCACCTTGGCCAGGTCCCCTCCCGGAACCACCGTCGGCGGCTGGTAGTTTATCCCGCACTTGAACCCAGTCGGACACCAGTCGACGAACTG
CACGGTCCTCTTGGTCTTGATGGAGTGGACGGCGGAGTTGACGTCCTTGGGCACGACGTCGCCGCGGTACATGAGGCAGCAGGCCATGTACTTGCCGTGC
CGGGGGTCGCACTTGGCCATGACGCTCGACGGCTCGAACACGGAGTTGGTGATCTCGGGGAC
page-top