Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17249  (registered. 2012)
Contig Information
Length 1084 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 9
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 9
WH_SP 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 510
Evalue 1.00E-142
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17249
CTCCGATCAGCAGAGCAATGGCGGCCACCACCATGTCCCTTTCCTCCTCAGCATTTGCTGGCAAGGCAGTGAAGATTGTGTCATTGTCGACTCTCTTCGG
TGAGGAACGTGTCACCATGCGCAAGACTGCGGCAAAGGCAAAGCAAGTTGCCTCTAGCAGCCCGTGGTACGGGGCTGACCGCGTGCTCTACCTCGGCCCG
CTATCAGGTGAGCCACCGAGCTATTTGACCGGTGAGTTCCCTGGTGACTATGGGTGGGATACCGCCGGGCTCTCAGCTGACCCCGAGACCTTCGCCAAGA
ACCGTGAGCTGGAGGTGATCCACTGCCGATGGGCTATGCTTGGCGCGCTCGGTTGTGTCTTCCCTGAGTTGCTCGCCCGCAATGGTGTCAAGTTTGGCGA
GGCTGTTTGGTTCAAGGCTGGCTCCCAAATCTTCAGCGAGGGCGGCCTCGACTATCTCGGCAACCCCAGCCTCGTCCACGCGCAAAGCATCCTGGCCATT
TGGGCTTGCCAAGTTGTGCTCATGGGCGCTGTCGAGGGGTTCCGCATTGCCGGTGGCCCACTCGGCGAGATTGTTGACCCGCTTTACCCTGGAGGCAGCT
TTGACCCGCTCGGCCTAGCCGATGACCCTGAGGCGTTCGCGGAGCTCAAGGTGAAAGAGATCAAGAACGGCCGCCTTGCCATGTTCTCCATGTTTGGCTT
CTTTGTGCAGGCCATTGTCACAAGCAAAGGACCGCTAGAGAACCTCGCTGACCATATCACCGATCCCGTCAACAACAATGCATGGGCATTTGCCACCAAC
TTCGTGCCCGGCAAGTAAGACACCTACTAGGGCTGAGTTGAGAGCTGGCGGGGTGGTCTGATATGTACTACCATGATGTAAATTATAAGGATCCGTGCAA
ATGCATTGTTTGATTCATCGATATTCATCTTCTTTTTTTCTTATGATGATATTCATCTTCATGTCCCGCTTCTAGCTACTTGTAGTGATCACCTGGACAA
TTGGGTTTATTTAATTAGTACAACGCACACTCTGCTTCGCTAGACAATGACTTGTGGTAACTTACGTCAATACATGACGCCCAA
page-top