Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17248  (registered. 2012)
Contig Information
Length 712 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_SP 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62738051|pdb|1TX6|I|I Chain I, Trypsin:bbi Complex"
Score 252
Evalue 3.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17248
TCCATCACACATATAGGCTACTACCAGCAGTAGCGCGTGGTGGCAGGAGACCGGCCGTTCATTTTTATTTTATTCTTACACGAAGCTACTGCAGTCTGCA
GCAGGGCAGGAGAGGACACTCGACGACGGCGTTGATCGCGTGATCAATGGGCGTGCTAGTTCCCGCCGGCGGCGACAGCCTTGGGCGTGCACGCGGGCGG
GAAGGGTCCAAAGTAGCTGTCGATGCAGACGCGGCGGGAAGGGCGCGACCTGGACGGCAGGCATGTCTTGCAGGTTGGGGAACATTTGTCGACCTCGTCG
AGGCATTGACACGTCGGCGGGTTTGACCTGGTGCCCCGGGGCAGGTCGCAGCACTCCCACGGCCTGCAGATGGGCCCCGGGTCGCCGACGTACTGGTCCT
GGCAGACGAGGCGGGACGGGTCAGCCATGGACGGCCCGCAGGACTTGCAGGTGGAGGGGCACTCGAAGAGCTCGTCCATGCAGCGGCAGATCGGCGGGAT
GGATCTGGTGCAGAAGGCCTTGTCGCAGCACTTCCACGGCCTCTTCTTGGCCGCCGCCATGGCTGCTTCGTCTGCAACTTGGCCTTTGCTCGGCAGGAGA
ATGGCGCCCACGTCGCCGGCGACGAGGAGGGCTGCCGACTGCAGTGCTAGCATCAGCAGGATGCTAGGAACGATGCATCTCTTCTTCGTCCCCATGGCGT
GCTTTATTGAGC
page-top