Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17246  (registered. 2012)
Contig Information
Length 649 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_EM Dormant seed with water absorption 1
Wh_SHC Shoot grown with cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig17246
TTTTTTTTTTATCAGCACAATCTCACAACGATTTCTGCTCCTGTTATTACAACAAACAAACACGCCTAGCGAATTATATCTCGCAATTCCAACTCCTACT
ACAACCCGCGTGGGTCAGGATCGGATTCCTGCGGTACTACACATGGACTGAGATGATGCTCTAGAAATTGTACATCAAGAAACAAGCATTTTTTTCACAC
TGCTCAGCTAGAAAGAGCAAACACACTCTCTATGCACGCTCTACTACTACGCACGCCAGTGAGGGAGGGAGGGTCGCTCATCCGCGATCCACCCTTTCCA
CGGCATGTCAGATCTGGGCACTCCTTACCCGGCCCAGTCGTCATCGCTATCATCGTCCTCCTCCTCCTCGCCCATGTCGTCGTCCTGATAGGATTCATCA
GAGAGCTCCTCGTCTACCTTCGGCTTTTTCTTTTTCCGGGATCCGCTTGCTTCCTTCTTTGCTGCTGACTGTTTTCCCTTTGGAGTTCCTCGCTGCTTCT
TAGCAGGAGCTGCATCATCATCCTGAGAGGGATCATCCGAGAGCTCTTCAATTTCATCTTCTTCTACCTTTGCTTTTTGCTTTTTCTGAGATCCGCTTGC
TTCCTTCTTCGCTGGTGACTGTTTTTTCGTTGGAGTTGCTCGCTGCTTC
page-top