Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17203  (registered. 2012)
Contig Information
Length 1028 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 3
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453077|ref|NP_001050139.1|| Os03g0356300 [Oryza sativa (japonica cultivar-group)]
Score 418
Evalue 6.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17203
TTGTGATGATTGCCTAACTTGCGACATTGCTTTTAATACGGTTATGTCTCTAAATCGTGCCTCGACACGTGGGAGCTATAGCCGCATCGAGGGTGTTACA
CATCGCCATGACGTAAACTGTGACATTTTTCTCTACAAATTGTGCAAGGGCTAAAGAACATGGTAGTACTCGGAAGATGGCGGATTACAGAGGGAAAACA
GAACAAAAGTACGTAAGAAATGCAAACAAATAAATAAACAGCCTTCTATTTCTTCTTCCCAGCTTTGCCCTCCTTCCTCCTGACAATCTCGTCCTGGTAC
CGGATACCCTTCCCCTTGTATGGCTCCGGAGGCCTCCACTTCTTTATGGTGGCAGCAAACTGGCCGATTTCGCTCTTATCGTACCCACTCACGATGATTC
TCGTGTTCTCCTCCACCTTGACTTGAAGTCCTTCTGGGACAGCCATCCGGACAGGGTGCGAGAATCCCAGGTTCATCACCAGGTCTTTGCCCTCCACCGT
CGCACGGTACCCAACCCCCACTAACTGAAGCCTCTTGTCAAATCCTTTTGACACCCCCACGATGATGTTGTCCGTCAGGGTTCTGAAAAGGCCATGCATC
TGATTCGCCCTTTTGGTTTCCACAGTCTTGAATACTCTCAATTTGCCAGTCTCTTCTTTCACAACTTTTACTTCGGCGGGATAGTTTAATGTCAACTCTC
CTAGTAGACCCTTAGCTTTGACAAACTGCTCCTCTAGTGTTAGAGTAACATTTGATGGAACTTCAATCGGCTTCTTTCCGATTCTAGATTCCTTGCATTC
CACTGTTTTTCTAATGAAACCAACTCTGCCAGCAGGGATAACACGAAGAAGTATGCCTTGTGACTTCCCAAGGAAGCCAATTCTTGAATTGCAAGGGAGG
TGGAGGGAGGGGGAGAGGGACGCCATGGACGGGCTCCGTGTTGCCGCCGCTCGCTCGGTGTGCGCGCTTCTTCTTCTTCTTCGGGTGCAGATTTCTTATC
CTTTATCCACAGAAGAAGGGGGAAGAGG
page-top