Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17051  (registered. 2012)
Contig Information
Length 775 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
WH_XN Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092434|ref|XP_002436707.1|| hypothetical protein SORBIDRAFT_10g007360 [Sorghum bicolor]
Score 465
Evalue 2.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17051
CTGAAGCTTCGTGGGATTGAGGAGGAGACTTGGAGACAACATGTCACTGGAGGAAAGCTTCGGGAAATTACCGAGGAAGCGAAGGCTTTTGCGATTGGAA
ACAAGGCCTTGGCTGCTCTTTTTGTTCACACACCTGCTGGTGAATTACAACGCCAAATCCGAGCATGGCTTGCAGAGAACTTTGATTTTCTATCTGTAAC
TGGTGGAGATGTTGCTGGAGGAACTACTGGGCAACTTGAATTGTTATCTACCGCTATCATGGATGGATGGATGGCTGGCCTTGGTACAGCGCAGCCCCCA
AGCACTGATGCTCTAGGCCAGCTGTTATCTGAGTACAGCAAGCGTGTTTACACATCACAGCTACAACACTTGAAGGACATAGCTGGCACATTGGCAACAG
AGGAGGCTGATGATCCTGTTCATGTCAGTAAGCTGCGCTCTGCTCTGGAGTCCGTTGATCATAAAAGAAGAAAGATCATGCAACAAATGCGGACTGATAC
TGCCTTGTTAACCAAAGAAGAAGGTGGTTCACCTATCCGAAATCCTCCAACTGCTGCTGAAGATGCACGATTAGCATCTCTTATATCTCTAGACAACATC
TTAAAGCAAGTCAAGGAAGTAATAAAACAAAGCTCTACAAGACCATTACGAAAATCAAAAAAGAAAGCATTGCTAGAATCATTAGATGACCTATTGGCAC
AGATGCCTTCTCTTCTTGACATTGATCNNNNATGTGCTCAGAAGCAGATCACGGATGCACACAATGCTGTAGAGT
page-top