Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17048  (registered. 2012)
Contig Information
Length 1444 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VSCB Liquid cultured tissue 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445841|ref|NP_001046700.1|| Os02g0325100 [Oryza sativa (japonica cultivar-group)]
Score 785
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17048
TTTTTTTTTTAGATTGAACGTGCACGCCCTTTATACTTTTCCAACTAGAAACACAAAATAAAACAGTAGTTGAATCTGATCAAATAGATTGGGGGCATGC
AGGATACAAGGATATTAACGTCGCATAGAGGCTGACTATCCACAAATTCATCTCTAACACTTCGTTGCCTCACTTGTAGAAGTCAAAATCTGTATCAGGC
TTCTTGACGTTGGTTCGGTAACCCTTCTCGAAGTCCTTGGGGAGAATAACATACCGATTTTTCCGAACAGCATGCATGCCAGCTTCCTGACAAATAGCGG
TTATATCTGCAGCGCTGATTTTATCCGGTCTTGAGACATAATCTTCCAAATCAACCTCGTCACTCAAATTCATTTTAGAAGTACAAACTTGGAAAACAAG
CCTCTTCTGCCTCCGGTCTGGCAGAGGGAACTCAATTTTCCTGTCCAGTCTTCCTGGACGCAGAAGAGCAGGATCTAGAGTATCTGCCCGATTGGTCGCC
ATTATAACCTTCACATTCACCGTCTGATCAAATCCGTCCATCTGATTGAGCAGCTCCATCAAAATACGCTGAACTTCTCGGTCAGCCCCAGTCTGAGCAT
CGAATCGGGCAGTTGCTATAGCGTCAACCTCATCAATGAATATTATAGCCGGCGCATTTTCTTTAGCTAAGCGGAATACATCTCGAACCATCCTTGGGCC
CTCACCCAAGTACTTCTGCACGAACTCTGAACCAACCACTCTGATAAAAGCAGCAGTAGTGTGATGTGCCACAGCTTTAGCAAGCATGGTCTTGCCAGTG
CCTGGAGGACCATAGAGAAGCACCCCTCTTGGAGGATCAATACCAATCTGCTTGTACAACTCATGGTGTGTCAATGGTAGCTCAACTGCCTCCCGAATTT
CTTGTTTTTGAATATCACATCCTCCAATGTCCGAATATAGGACGTTGGGCTTCTCCGATGAAGCGAGCAGCGATATGCTGGAGTCGGCCTCGGGCGGCAG
CACATCGACGAGCGCGTTGGAGTGGCGGTGCAGGGCGACGGACGCCGACGGCTTGAGCAGCTCGCGGTTGATGGTGCTGAGGATCCGCACATAGTAGTTG
CTGCCGGTGGTGGATCCGACGATGCCGTTGTTGCCGTCGACCATCTCCATGAACTGGCCGATGACGAGGGGCACGGACTGGATCCGCTTGACCTCCTCCT
GCGCGCGCAGCAGCTCGCGCTTCAGGTTCTTCTGCTCGTCCTTGACGTACTCCTCCTGGATCTCGACGAACTCCATGTGACGCTGGAGCGATTTGAGACG
GCCGTAGAGGTCGTCGTCGTCCTCGGCCGCGGCGGAGGAGGAGGCGCAGTGGGCGGCGGTGGCCGGGTAGGAGGGCGGGGGCGCCGACGGGAGGGCCGCG
GGAGGGTTTGCTACGGTCGCCATGGCTAGGGTTTGGTGTCCGCT
page-top