Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1700  (registered. 2012)
Contig Information
Length 1479 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 3
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655435|emb|CAJ01702.1|| putative AdoMet synthase 1 [Hordeum vulgare subsp. vulgare]
Score 801
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1700
TTCGGCACGAGGATTCGACCTCTTCCTTTCGGTTCTTCGGCCTCCTGAAGAATAGCATCAGCACAACTGCACAAGAGCATCGCTAGCACGGAAGAAATGG
CGGCCGAGACGTTCCTCTTCACGTCCGAGTCCGTGAACGAGGGCCATCCTGACAAGCTGTGCGACCAGGTCTCCGACGCCGTCTTGGACGCCTGCTTGGC
CCAGGATCCCGACAGCAAGGTTGCCTGCGAGACCTGCACCAAGACCAACATGGTCATGGTCTTTGGCGAGATCACCACCAAGGCCACCGTCGACTACGAG
AAGATCGTGCGCGACACCTGCCGCAGCATCGGCTTCATCTCTGACGACGTTGGTCTGGATGCTGACCATTGCAAGGTGCTTGTCAACATCGAGCAGCAAT
CCCCTGACATTGCCCAGGGTGTTCACGGACACTTCACCAAGCGCCCCGAAGAGATCGGCGCTGGTGACCAGGGCATCATGTTCGGCTACGCCACTGATGA
GACTCCTGAGCTGATGCCCCTCACCCACATGCTCGCCACCAAGCTTGGAGCTCGCCTTACCGAGGTCCGCAAGAATGGCACCTGTGCCTGGCTCAGGCCT
GACGGAAAGACCCAGGTCACCATTGAGTACCTAAACGAGGGTGGTGCCATGGTGCCTGTTCGTGTACACACCGTCCTCATCTCTACCCAGCATGATGAGA
CCGTCACCAACGATGAGATTGCCGCGGACCTCAAGGAGCACGTCATCAAGCCGGTGATCCCCGGGAAGTACCTCGATGAGAACACCATCTTCCACCTGAA
CCCGTCTGGCCGCTTCGTCATCGGTGGACCTCACGGTGACGCCGGTCTCACCGGCCGCAAGATCATCATCGACACCTACGGTGGCTGGGGAGCCCACGGT
GGCGGCGCCTTCTCTGGCAAGGACCCGACCAAGGTGGACCGCAGTGGCGCCTACATTGCTAGGCAGGCTGCCAAGAGCATCATCGCCAGCGGTCTCGCAC
GCCGCTGCATTGTGCAGATTTCATATGCCATTGGTGTGCCTGAGCCCCTGTCTGTGTTCGTCGACTCCTACGGCACCGGCAAGATCCCCGACCGGGAGAT
CCTCAAGCTCGTGAAGGAGAACTTTGACTTCAGGCCAGGGATGATCAGCATCAACCTGGACTTGAAGAAAGGTGGAAACAGGTTCATCAAGACCGCTGCT
TACGGTCACTTTGGCCGCGATGATGCCGACTTCACCTGGGAAGTGGTGAAGCCCCTCAAGTTCGACAAGGCATCTGCCTAAGAACAAGACATCGCCACAT
TGGGGTTATTCTTGGTCTGCTGCCTCTCAAGTTCAACAAAAGGCGGGATCCTTTTGCTCCTGGGAAGTAAGAAGAAGCATTCGACATCACCGCGACGTGC
TACACTGGTTGGGCCGTCTAGTGATCAGTGCTAAGTTTTCTTACTGGTGTATCATTTCATACATTTTTCCTTTTTTTTT
page-top