Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16851  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|257071834|gb|ACV41079.1|| phosphomannomutase D1 [Triticum aestivum]
Score 342
Evalue 2.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16851
GCGCGCATACAAAATCCGCTGTTTGTGAATGTATGTATACCATGTGTATACCAATACCAGTTCTGTTTACAACAACAATAGCGATAAACTACACCCAACG
GGGAGGAACGCAAAAAATGTACCGAGTTCAAAGGGAGATCTATAAAGGAATTATTCCGAGACGGCGAGCGGTTCGAGGGGTGCGGGTGAACAAATGAGTG
TAAATGGCACGGTAGTCTGGCGATCACTCCGACAGGAAGATGGATTTGCACTGCTGCACCGTGTCATTGGGGCTGGTAACTGTATGACCAACTGTTCTTT
CAGATTCAAATATCTCATGATCATTGCCACCCTTGTAGGTTTTGTCCCCAAAGAAATGGATTTCTTTGAATTCTTCGAGATATCTCAAGCAGTAGGTTTT
GTCCCAGCCTTGCGGGAATACATCAAAACTGATCTGCCCTCCAATAGAAAAGGTCAGGTTCAGGTGTGCAAACTTTTCGCGAAGCACTGACACCATTTTA
GGCCGAACGTTATGTACCTTATCATACTTCTCAAAATCATCACGTTCTTCTTGACTACAGTTCCTCCCTATAGGCGACACATTGATCATTCCACTCCTGA
ACTCTATGAATGTACCCCTTTTAATTGGGATATCCAAGTCCGCAATGTAATGAAGAGTGAAGTTAATGAATTCCTTAAGCTGGTCATCTCCAAGATACGT
TTTCAAGCTTTGCGTCCCNNNCGTGCCGAATTCGGCACGAGGGTGCCCTCGGCCGAGTGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCG
GGATTCTGCAATTCACACCAGGTATCGCATTTC
page-top