Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16827  (registered. 2012)
Contig Information
Length 1568 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XE Seedling, infected with leaf rust 4
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452137|ref|NP_001049669.1|| Os03g0268000 [Oryza sativa (japonica cultivar-group)]
Score 633
Evalue 2.00E-179
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16827
GCACAGCCCATCATGCTGGTCTGATTGAACAAAAACTCAAAGCCATCCAGCACTTGAAAGGTGAAGCCTACATCAGGAACATGCTGAATATTTTCTCATC
AAGTTCCCACCAAGCATCAGCTTTCTTTGTGCTCATACTATTTGAATTGTTACCATTACCGCTCTCTAAAAACTAAAATAAAACTCATCCAATATTTGCT
TACAGCAACAGAAACACAGGCTTGGCTTTTGTTCTTACCTCAGTAAGTGATACAGGTGCTTTTTAGATAGTGGAACTCCCAAACAGAAAACTCTCATATT
CAGAACTTTTTGTTTCTTGCTGGAGGGGATCATCTTGCGTCAATTGCGAACTTCAGCCTTCCATAATCAATATATCTACAGCTACAAGATAGTTTCACAC
CCGGTGGGAACAGAAAAGGAAAAAATTCTGGCACTTGCTATGAAGAGTAACTTTCAGACCAACTGTTAGAAATGATATTATTTGACTTCTCCAGTAGAAC
TAGCCCGATGCTGCCTTCAAGCATAGCGCCTGCGCGTTGATGTCTTGATGTGATTGTGTCCACATGAGAGCCTCAGAGCCTCTAGAAGAGGAAAGAGCTT
CATCATTTCACATTTTGTTTGACGCCATAAATTTGATTTTTCTCTCGGCAGGTTTGAGAATTTGAAATGAACACATCAAAGTTTCATCAACACTCATCAT
TGCTCCAGCATTATCAAATTCACCACAATAGTTGGGAGCCGAAAATATGGTGACCAGCTGTCTGTCAGCAAAGAATTCATACCCATCCTCGACAACCTGG
TGGGCACGGCAAATAAGATCAAGATCATGCTTTAGAAGGAACTCCGTAACTTTGTCATGACCAAATGTGAATGAAACGCCCCTATCATTCATGCCCCACC
CTTGGACATCTTTTCCTGGATCAGACCAAAGAAGATCGCATAGTAGACCTGTATCTGGCACATCGGTAGGACGGGGCAAGTTTTTTATCTCATCTAGGTG
TCCCAGATCAGGAGAAAGGCCACCATGCATGCATAATATTTTATCATCAATTAGAGCGGCCACAGGGAGACAGTTAAAACAGTCGGTGAAGACCTTCCAT
AGCCGCACATTGAAGCGACGCTTGCATTCATCATAAAATCCATATATTCTGTTTATTGAAGCACACTCATGGTTGCCTCTCAGGAGAAAAAAGTTCTCAG
GGTACTTGATTTTGTATGCAAGGAGGAGGCATATAGTCTCCAGACTCTGTTTGCCTCGATCAACATAATCGCCTAAGAATAGATAGTTGGCTTCCGGGGG
AAAACCTCCATACTCAAATAGCCTTAAAAGATCACTGTACTGACCATGGATATCACCGCAGATCTTGATGGGCGCCTCGAGCTCGAGGAGGTTGGGCTGG
GTGAGGAAGATGTCGCGGGAGGCGGTGCAGAGCTGGCGGATCTCCGACTCGGAGAGCTGCACCTGCTTGCCGGGGCGCGCCGTCCGCACCTCGAGCAGAC
GGCGGATGATGTCGTCGAGGAGCGCGGCGTCCATGCCGCCTCCCTGCCCTCCCGCCGCCGGCGCCGCC
page-top