Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16782  (registered. 2012)
Contig Information
Length 935 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453279|ref|NP_001050240.1|| Os03g0381200 [Oryza sativa (japonica cultivar-group)]
Score 486
Evalue 1.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16782
AGAGTAAGAAGCAGAGAGGGGTTGGATCCAAGAAGAGGGTGGGGAGGCTACATGGAGGCGGCGATGGATCTGATGCGGCGGATGCCGCCGGGGAGCACCG
AGACGGCGCTCAACGCGCTGCTCTCCCTCCTCCCCGACCACTCCCTCGACCTCCTCTCCCAGGTCGACCTCCGGCTCCAGGTTTGCATGGATAAGGAGAA
CAATAAGGAATACATTCTTTGCGAGTATAACCGCGACACCGATTCCTATCGATCACCTTGGTCAAACATATATGAGCCTCCTTTAGAAGATGGGACAGTT
CCCTCAGAAGAGATGAGGAATCTTGAAGTCGAGGCAAATGAGGTTTTCTCTGTCTATCGTGATCAGTACTATGAAGGTGGGATCTCATCTGTGTACATTT
GGGAGGATGAAGACGAGAGTTTCATTGCATGCTTCTTAATAAAGAAAGATGGACAAGGGAAAAGAAGTTATATGCAAATAGGTTCGTGGGATGCTATTCA
TGTTATCCAGGTTGGTCCTGAAGAGGAAGGAGCAGCACATTACTGCTTGAACAGCACTGTTATGCTGTCATTGACAACAGATAACAAGCAATCGGGAACT
TTCAACTTGTCCGGATCAATTAGGCGGCAGATGAGCATGACTCTCGCTGTGGCAGATGGGCATCTGGTTAACATGGGGAAAATGATAGAAGAGATGGAGG
GCAAGCTGAGAAATTCACTGGACCAGGTCTATTTTGGGAAAACCAGGGAAATGGTTTGCACTCTTAGGCCACCGCCTGAAGTACTTAACATGAGACTACC
CGACAGCTGATCAGATAAATTGATAGCAATGCCAATTTAACATGGCGTTTTATCTCTAGTGTCATATCACTTTCCGCATCTGTATCTGTATTTAATCACA
ACAGAGTTTTCTTGTCCTTTGACGTGTGATGACGA
page-top