Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16755  (registered. 2012)
Contig Information
Length 1051 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 449
Evalue 3.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16755
TTTTTTTTTTGCACCAGAAAGATCGCAAGAAACCACATAAAACACAGCAAACATCAGGCAAGACAAACAAAATTATGGACCAAATTAAGCGCTCACTTAT
TCATAGTTCACCAAAGCTGCTCCACACCAGCAGAAGTTTGAAGATACAAACGATAACACTGCATCACAGTATGGTACAGAAACAAAGACAGTTCAGGCAA
CGACAGACACAGACCAGACTCCATTGGAGGATACCGGAGACACCGAGACTTGTGAACCCAGAGACAGAAGCAGCTCCATGGCCAGGAGCTTACTGGCCAC
CACGGAGACGGAGCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTGTAGTCCGCCAAGGTGCGGCCATCCTCAAGCTGCTTACCGGCAAAGATGAGACG
CTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTCGCCTTCACGTTGTCAATGGTGTCAGATGACTCCACCTCCAGGGTGATGGTCTTGCCGGTG
AGGGTCTTCACAAATATCTGCATGCCACCACGGAGCCTGAGCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTGTAATCCGCAAGGGTGCGACCATCCT
CGAGCTGCTTGCCGGCAAAGATCAGGCGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTTGGCCTTCACATTGTCAATGGTGTCCGAGGACTC
AACCTCCAGGGTGATGGTCTTGCCGGTGAGGGTCTTGACAAAGATTTGCATGCCACCACGAAGGCGGAGGACAAGGTGGAGGGTGGATTCCTTCTGGATG
TTGTAATCCGCAAGGGTGCGGCCATCCTCAAGCTGCTTGCCGGCAAAGATAAGACGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCT
TAACATTGTCAATAGTGTCCGAGGACTCAACCTCAAGGGTGATGGTCTTGCCGGTAAGGGTCTTCACGAAGATCTGCATCTTAGGAGGAGGAGGAGAGAG
CCTTGGCTTCGCTTCGCTTCAATCGGAGACTTCTCGGCGAGATCGGAGGGG
page-top