Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16733  (registered. 2012)
Contig Information
Length 800 bp
Clones alternative view 137 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 15
Wh_V4816 Shoot grown under cold condition for 16days 22
Wh_V483 Shoot grown under cold condition for 3days 26
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 7
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 16
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XE Seedling, infected with leaf rust 14
WH_XF Seedling, infected with leaf rust 14
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|157073742|dbj|BAF79926.1|| group3 late embryogenesis abundant protein [Triticum aestivum]
Score 344
Evalue 7.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16733
TTTTTTTTTTTTTTTTTTTTGATTTTGTGAAAAATATATTCATACCTCGGTCGCATACATCAAACAAAGTTACACCAAGGAGTGTGTATAAATCAGTCTC
TTGAAACTGAAATTTAATTTATATTGGGGGAATAACAAAACGAAAGGAGGGCGAGGGTAAGCAGGCGCGTCTAATTATCGTTTATGATCTTCTTGGTGCC
GCTACCCGCATCTTATTTGTCTCCTCCCATCCCGAGTGTGTTCATCACAGCATCCTTGGCACCCGTCGCGGCACCCATCATATTCCCGCCAGCCTGCTGG
AAGACGTTTTCCTTGGGGGCGACCGGGGGATCCTTGGTGTACTGTGCAGCGGTGTCTTGGACATACTGCGCGGCCTCGGTAGACTTCTCCTTGGCGGCGT
CGGTGGTCTCGGTGGCCGTCTTCTTGACAGCCTCAGTCTTCTCGCTGAGGAAGCCGCCCGTCTGGTCTTTGCCCTCGACGGCGCGATCCTTCCCGGCTTC
CACTGTCTCGGACGCCTTCCCCATGGCCTCGCCACCCATCTTTTTGGCCGCCTCAGTAGTCTCGGAGGCAGCCTTCGTGACAGCCGCGCTCTTCTCGCCA
AGGAAGCTGCCGGTCTGGTCTTTTGCCTCGACGGCACGGTCCTGGATGGATTGCCCCGTCTCGGACGCCATCTTCTTGGCCTCGCCGGCCTTAACTTGGG
TCACGTCCACCACCTCCCCGGACTTCTCTTGAAACCAGCCAGACATCTTTGAAGTCGATGGAGTACTGGTACCTACTAATTTGTGTTCTTCTTTTCGGCA
page-top