Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16672  (registered. 2012)
Contig Information
Length 838 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig16672
TTTTTTTTTTAAACATAACAAGAGGATTCAGTTCTTCATCTCATTAAGAAAACGAGCCATTACAGACATATATAGTGAAGGTAGCAACAGACCACAGCCT
ACGACCATTACAAGTTCAACCATGCTTCCAACTGTGCCATATTTAAACCATCACACCCCAACTCTAATAGATATAAAAAGCACAGAAGGCTATCAGCGAA
TTAACTACTTATAAAATAGATAAATGCAGGGACACGTTAAAGACAAGATATAGATGCCTGGAGCTGAAGGTAATTAACCACAACAATCGAAGCAAGAGCT
ACACTGTTGAAAGCGCCACGAGTTGAGCTGCTCTTCTTTTTTTCCATCTATATCAGACGATTCTTCTTTTCCTTGTGGAGAAGACAATGAGACCATCCAG
TGTGGTTCGCGCAGAACTTGGCAGCAACCAGGGAAGGTATGTCAGGATGGAAATCTTTGGAAGGCTGGACTTCTTCCCATGGCGCTGGCGCCGGCAAGCC
ATCTTTGATCGGACGATGGCTGCAGGACAGGAGAGACTTTGTGCGCATGTCGATGCTGATCACACACTCAATCTCCCTGCATAGCCGAGCCCTTCTCTCC
CAATCGAGGTAGTAATCTCCCAGCAAGAGGTAAAGGACACCATCCTCGTCGGCCTTGAGGACTGGGCACTGCGGCATGGCCTGCGGCAGCCTCTCGCGCT
TGTAGACCTCCGACTGCCAGAGCAGGGGCAAGGGCAGCTCCATGTCTTGGTCTCTCGTCCATGAGCGGAGATCTGGCGACAGGGTCCAGCTCCGCAGCAC
AACGTCGNCAGGGGGCGTGTTGTCACGGGGGTTGTCGC
page-top