Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16670  (registered. 2012)
Contig Information
Length 1147 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig16670
ATCTAATAAATAAAACCAACAGCTGTGCCATAATTTGTGAAACAAGGTCCACAAAATAAAAAATAAAAAATTATGTACAAACCAATGAACCAAATCGATG
TAATGTTTAAGCTACAACAGTAGCATAACTGTTCAAATTGCGACTTAATGAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCA
GATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTACTAGGTACTTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGTCCAGAA
TCAAATAGCTCTTCACGTCTCTTCAGCCATCGAAGCTCCAACGAGAGAAACATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATTTGGGTA
ATACACGGACCACTTACAGCTGTTCAAGCTACATAAATTATTTCTAACATAAGACATCTTACATTATGAAGCAGCTGACCACAAGAAATAGGGTCTAAAA
TGTTCTTACAGGATAATATGATCCTTCCATACAGAGAAATACTTAAATTTAGTTCAGAATATCATACAAATAAACACAATTTTGAGTGAAGAACATATGT
GCAAGATTTGGTTATGCTGGACTGCATGTAGTTGTCGAGTACAGATTTGTGATGATGTTGTACAATTTCTCTATATCAATGCAAGTAACTTCTGAATGAA
TTCAAGATAATTTTTGAATGAAATAGGTACTTTGTCAAAGCTTATGTACGGTTCAGCGGTATGTAAATTATCAATTGTACCTTTGGTCTTTCGAGGGTAG
CTCCATGAACGATTTGCGACGGTAGAACGTTGTGCCATGTAGTCGGATCGGACGAGGGGTGCGGACAAAGGAGCACACCAGCACACAGGGGGGAGAACCC
GGGGCTAAAACAAGATAACCCCCGTGCGATCTCCCCCCGAGACAAAAAAACATCTTTATTATGGTGGCGGCCTGCCATGCGAGCGCACCCAACATGGCAA
AGGCCTCTAGATGTTCACATCTCTTTTTTTTCACTCTCCTCCGACCTCTCCACAAGCACCTCGCTTGCTACATCTTCTTACCTTACGTCACCTCCGATCT
CTTAGATCTAATAATTATCGACATAGCATCGAATAATTATCAACACA
page-top