Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16582  (registered. 2012)
Contig Information
Length 1637 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66346995|emb|CAE00460.2|| branched-chain amino acid aminotransferase [Hordeum vulgare subsp.
Score 743
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16582
GCGGCTCCTGCTGAGCATAGCTCGCAAAACGTATCGGCTGGCCATTATATTGCTCGCGAGTTCTTGAACAACGTTGGCGATCGATCTAGCTAGCGGGGCG
CCCGGGCGTACGTGCGTGCATGGCTGTGCTGTCGTCTGCGAAGCGCCTCCTCCCGTGGGGCCGCGCCTCGGCCGGCGGGGTCAGCGGCGGCCTCCGAGCT
CTACTCGGGACGGACGGAGGCGGCGGCCGCTCTCTTCTCCCGTCCCGGTGGAAGTCGTCGCAGCCGCAGCTGGACCCCGTCGACAGGTCCGACGAGGAGG
GCGGCGGCGACATCGACTGGGACAACCTCGGCTTCGGGCTCACCCCGACCGACTACATGTACGTCATGCGGTGCTCGCAGGAGGAGGGCGGCTTCTCCCG
CGGCGAGCTCGCCCGCTACGGCAACATCGAGCTCAGCCCCTCCTCCGGCGTCCTCAACTACGGGCAGGGGCTGTTCGAGGGGCTCAAGGCGCACCGGAGG
GCGGACGGGCCCGGGTACATGCTGTTCCGGCCGGAGGAGAACGCGCGGCGGATGCAGCACGGCGCCGGGCGCATGTGCATGCCGTCCCCGTCCGTGGAGC
AGTTCGTGCACGCCGTCAAGCAGACCGTCCTCGCCAACAGGCGCTGGGTGCCGCCGCAGGGAAAGGGAGCATTGTACATCAGGCCGCTGCTCATCGGGAG
CGGGGCGATCCTCGGGCTGGCGCCGGCGCCGGAGTACACCTTCATGATCTACGCCGCGCCTGTGGGGACATATTTCAAGGAAGGCATGGCGGCGATAAAC
CTGCTGGTCGAGGAGGAGATCCACCGCGCCATGCCGGGCGGCACCGGCGGGGTCAAGAGCATCTCCAACTACGCGCCGGTGCTCAAGGCGCAGATGGACG
CGAGGAGCAAGGGGTTCGCGGACGTGCTGTACCTGGACTCGGTGCACAAGAGGTACGTGGAGGAGGCCTCCTCCTGCAACCTCTTCGTCGTGAAGGGCGG
CGCCATCGCGACGCCGGCGACGGAGGGGACCATCCTGCCGGGGGTCACGCGCAGGAGCATCATCGAGCTCGCCAGAGACAGCGGCTACCAGGTGGAAGAG
CGCCTCGTCTCCATCGACGATCTGATCAGTGCAGACGAAGTGTTCTGCACGGGAACGGCCGTCGGCATCACCCCGGTGTCGACCATCACCTACCAAGGGA
CAAGGTACGAGTTCAGGGCTGGGGAGGACACGCTGTCGAAGAAGCTGTACACGACTCTGACATCGATCCAGATGGGCCTGGCGGAGGACAAGAAAGGATG
GACGGTTACGGTTGATTGATTAGGATAACAGCGTGGGCGCATGCGGCGCCAGGAGCATTCATCAGTATTTCTTATTATGTCTTTCCAATGTGAATAATAA
TAGTGATGGTGATGATATCTCGGGGATGTCTCGGCCCCGAGGGGCGATGGTTTCTCTGATGCTACTGATTTCTTGGAAAATGTGGAAAGAGAAAAATGTA
CGTGTGTTCCATAACAACGTAGTTCCCGTGGGTGTTCTTGTTGCTCGAACAAAAGAGGAAGCTTCTCTATGGTGCCTAGCTAGGGTGAAATTTTTGTGTA
ATATTATGTCACGACAGTGAGGCTTGTAATTCCGCCC
page-top