Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16576  (registered. 2012)
Contig Information
Length 1034 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 16
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31753114|gb|AAH53854.1|| Unknown (protein for IMAGE:5194336) [Homo sapiens]
Score 524
Evalue 6.00E-147
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16576
CACACAATACACATTCCGCCTTAGCAGCGCAATGGCGACCACCACCATGTCCCTCTCCTCGACCTTCGCCGGCAAGTCGGTGAAGAACGTGGCTTCATCA
GCTCTCTTTGGTGAGGCCCGTGTCACTATGCGCAAGACCGCTGCAAAGGCCAAGCAGGTTTCATCAGGCAGCCCATGGTACGGTGCCGACCGTGTGCTCT
ACCTCGGCCCGCTTTCCGGCGACCCTCCGAGCTACTTGACCGGCGAGTTCCCCGGCGACTACGGGTGGGACACCGCGGGGCTCTCGGCCGACCCCGAGAC
CTTTGCCAAGAACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGTGCGCTCGGATGCGTCTTCCCCGAGCTTCTTGCACGCAATGGTGTT
AAGTTCGGTGAGGCCGTGTGGTTCAAGGCCGGCTCCCAAATCTTCAGCGAGGGTGGCCTCGACTACCTGGGCAACCCCAGCCTCGTGCATGCACAGAGCA
TCCTTGCTATTTGGGCATGCCAAGTCGTGCTCATGGGTGCCGTTGAGGGGTACCGCGTTGCCGGGGGCCCACTTGGTGAGATAGTCGACCCACTCTACCC
TGGTGGCAGCTTCGACCCGTTGGGCCTGGCTGATGACCCCGAGGCATTTGCAGAGCTCAAGGTGAAGGAAGTCAAGAACGGCCGCCTCGCCATGTTCTCT
ATGTTTGGCTTCTTCGTGCAGGCCATTGTCACCGGTAAGGGCCCACTCGAGAACCTTGCTGACCACCTCTCCGACCCCGTCAACAACAACGCATGGGCGT
TTGCCACAAACTTTGTTCCCGGCAAGTGAGGCGTTGGCGCTCGCTAGCTGCGAGTTGTACCCATCAAGGAAACTGCGGTGAACTGCACACATAATATGTG
GTTCAAATTGTAACATCATGGTGTAAATTACAAGGATCGTTGGGGAAATGGTTTGATCTGCCCGCTTGTTTCATGTCCTGGATGTAGCCTGTGCGTTGCT
CCATGAGAAATGAGAACGATAAAATTTGGGCTAT
page-top