Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16526  (registered. 2012)
Contig Information
Length 1509 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458986|ref|NP_001053093.1|| Os04g0479200 [Oryza sativa (japonica cultivar-group)]
Score 673
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16526
TTTTTTTTTTGACAGTGACATGCATAGCAATTCAGAAGACCAGATTCCCTTTCCAAAGAAAAGAGGACCGGATTCCGGTTACATGGGAGTGATAACCACG
AATAAGAACTGAGAATAAACTTTCAATGCATGCCGTTTAAATTGAAGGTAGCCAGCTACCCCCTCTGCAACACAAGGTGTTTTGCCTTGCTACAAAGTAT
CATGGGAAGAATAATCCTCGTGGGTTTCTCAATTATTTCTGAAATATATAATTGCCGATCTAACGCTGTACGGAAAAAATAGCACTCAAAAGTTGGGACC
TGTAAACCAGTCCTCCAAAAGAATCGATTCTTCAGGCGTGCATCAGGTATCTAATCCAGATTAGCGATCACTGCATCAGTAACTTCCTGGGTGGTGCTGG
TGCCGCCCAGATCCTTTGTCCTGTACTTGCCCTCTGCAATGACCCGCTTCACCGCAGTTTCCAGACGGTCAGCGAACGACGGGAACTGCAAATGCCTCAA
CATCATAGCGGACGACAGGAGCAGGGCGACAGGGTTTGCTTTCTGCTGCTCTACAAGATTGTCATTTCCCACATTTCCTGCAGAAGCACCTTGCTCGAAG
ATGGCATGATCCTGACCCACATTACCTCCCGGCATGACACCTGTTCCTCCAACAAGACCTGCAGCTGTGTTGGCAACCAAATTGCCGTAAAGGTTAGGCG
TAACCATAACATCAAATTGCTCAGGCCTTGAAACAAGTTGCATGCAGCAGTTGTCAACAATAATTTCGTTATACTCAATACTTGGATATTTAGCGGCAAT
CTCACGGCAAGACTCCAAGAACAAACCATCAGCAAGTTTCATGATGTTTGCTTTATGCACTGCCGTGACTTTCTTCCGGTAGTTAAGGTAAGCATACTCG
AAGGCATATTTGGCAATCCTCTCAGAGCAAAACTTGAGGCTCTCGACGACCCCCGGGACGACCTCGTGCTCGAGGCCCGAGTACTCGCCCTCGGTGTTCT
CCCTGATGACGACGATGTCGACGTTCTGGTGCCTGGTGGGCAGGCCGGGGACGTTGGCGCAGTTGACGAGGGAGGCGAAGAGGTCGAGCTCCTTGCGGAG
CTGCATGTTGAGGGAGGAGACGCCCCCGCCGACGGGGGTGGCGAGGCCGCCCTTGAGGCAGACCTTGTTGCGGCGGATGGACTCGATGACGGCGGGGGGC
ACGGCGGGCATGTCGCCGTGGACGTCGTAGGACTCGAAGTAGACGGGCGCGTGCATCGCCTCCATGACCTGCTCGACGGCGCCGGTGACGAGGGGCCCGA
TGCCGTCGCCCGGGATGAGCGTGACGGGACGCGGGGTGCCGTCGCCCGGGCGAGGCATGTAGGTCACCGTGCGGCGCGCGCCGCCGCCGTGGCCCGGGAG
GGGCGGCGCGGAGGAGACCAGGCGGCGGAGGAGTGGGGCGGATCGCCGCGCCATCGGGGGCTGGCTGGGGCTGCGGCTGCGGCGGGGCGATGCGGAATTG
CGATCCGGT
page-top