Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16519  (registered. 2012)
Contig Information
Length 1281 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195638270|gb|ACG38603.1|| ankyrin repeat domain-containing protein 2 [Zea mays]
Score 554
Evalue 8.00E-156
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16519
AGGGGGCTTCCCCAACAGGTGGTGCAGGCCTGCCCAGTCCTTTTGATTTCTCCAACATGAGCAGCTTGCTCAATGATCCATCTATAAGGGAGATGGCTGA
GCAAATCGCCAGCGACCCTGTATTCAACCAGATGGCTGAGCAGCTTCAGAAAAGTGCGCAGGGTGCAGGGGAACAGGGTGTTCCAAATTTGGATCCTCAA
GCATACATGGAAACCATGACACAAGTTATGCAGAATCCTCAGTTTATGTCAATGGCGGAGCGTCTTGGGAATACTCTTATGCAGGATCCTGCAATGTCCA
GTATGCTTGAGAACTTGACTAGTCCAGCTCACAAAGAGCAGCTTGAAGAGCGAATGGCCCGTATCAAGGATGATCCGTCTTTGAAGCCAATTCTTGATGA
GATAGAACGTGGTGGTCCATCTGCAATGGTGAAGTACTGGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCCATGTCATTGAACTTCCCAGTAGAT
GCTGCTACTTCCACTGTAGTATCTGGACCTCAAGAAACTGATGAAGAGGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTTGGTGATG
CAGAGGGTCTGAAGAAAGCATTAGATGGTGGAGCAAACAAGGATGAAGAAGACGTGGAGGGAAGAAGGGCCTTACATTTTGCATGTGGATACGGCGAGTT
GAAGTGTGCAGAAATCCTTCTGGAGGCAGGTGCTGCAGTTGACGCACTGGATAAGAACAAGAACACCCCTCTGCACTATGCCGCTGGATACGGTCGGAAG
GAATGCGTGGATCTTCTCTTGAAGCACGGCGCTGCTGTCACGCTCCAAAATCTGGACGGGAAGACCCCCATCGAGGTGGCCAAGCTCAACAGCCAGGACG
AGGTGGTCAAGCTGCTCGAGCAGGACGTGTTCCTATGAAGCAAACCCTCAGACCTGGCCGCGCTCATCGATCCTAAAACTCTCCCTTGGTTCTGGACTCT
CGGCGGCGTCATATCGTGGCATGGTGTTGGTTGCTTTCCCTCGGTTTTACTTAGTCGGTAGCTCTCGCCTGTAACCTGTGTGGCCTTGCGGTGCTGCTTA
ACAAGAGTCCATCTTCTTCTCCGTTGGTTTGATCCTGCTGTGCAACCCTGTTCTTGGTCCATCTCCGTGCACGGGGGATATGGGTTCGCTGTGGGAGCTG
TCAGGGGTGATGATTGCGTATATACCCCTGTCGTGAATATTTCTTGGTGTTGAAAATGATACGTAAGGTGCAAAAAAAAAA
page-top