Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16509  (registered. 2012)
Contig Information
Length 1127 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 3
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222616681|gb|EEE52813.1|| hypothetical protein OsJ_35314 [Oryza sativa Japonica Group]
Score 426
Evalue 2.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16509
GGAACAGTTAATTCTAGATTATACTCGGTATATACAAAAGAAGAGCCCTCACACGAGGAGATTGCTGGGAATTCACATTTTAAAGTGAAAAAATTACAAG
AATTGTTCCAAGCACAAGAAGGATATCGCCAAAAAGGAATAAAGAAATAAAAATACACAAGGTCCACCTACGACATAGTCTGCCGTGGTCTTTCACAAGC
TTCAGTGGTAACCTAGAAACTGGATTCTCAAGCATCCTCGACCTGAGAGTTGAAGACAAAGCTTGGAAATGTTGTGGTAATATCCCTTAGATATGGGAGT
GTCATATTCTTCAACAAAGATGGATGCCTCAAGACAAGATTGCGCCATTCCTCCTTGTCGATTTTACCATCGTGCTTTGTATCTGCTTCCTCAAATGTCT
TGTCGATAATACCCTCTATAACCTCATCAGAAAGGTTCATTCCTGATTCAGCAAGTGTTGCAACCACCATTTGCTTCACCTCTTGCTTTTCAATGAAACC
TTGTTGTTTGAGATCATAGAGTTTGAAAGCAAAATCAATTTTGTCATCAACTGGTGCATTAGGATGGAATACAGAAAGAGCTCGCACAAATTCTTCAAAT
TCAAGAATCCCATTGTGCTTCGTATCGAACAAATCAAACACCCGGTCAGCAAACATGCTATCTTTCCTGTTAGTCTTAAACAGCGCCAGTTGGAATTCTT
CCTTATTAATCACACCATCATCAACCACAGCACTGCTGATCTTCTTGAACAACTCATACAATGCCTCAATCTCATTTACGCTAAAAACTGTTTCCCTTGC
CAGACGCTCAGGATCCTCGAGGCCCTTGGGACGATTTGGTATGTCGAGATCGCAGCACTTGAGCAGGAGAGCAGCGAGCCGTCGCAACCCTTCCGGGAAA
TCCACCATTTCACACTCCACCAGAAGCCAGATCAACGCGGCTCACACACACCTCATTGAGCCATCCCTGCGGCGGAGTGTGGGTACGGGAGCGACGGTCG
CCGGCGGTGAGGCAGACGAGGCGGTGATGGGAGAGGCGAGAGGAGGAGGAAGAGGAGCGCCACGTCAGCGGTTCTGGAACCTGGGGAGGATGCCGTCGGG
ATCTGAACCTGGGAGGATGCCTATCGA
page-top