Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16508  (registered. 2012)
Contig Information
Length 1579 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XF Seedling, infected with leaf rust 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242089363|ref|XP_002440514.1|| hypothetical protein SORBIDRAFT_09g002290 [Sorghum bicolor]
Score 459
Evalue 6.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16508
ATTACAATCATCTGTCTGTGAGGTTTCTGCATAGCATAATAAAAACAGGATACATAAATAAATAACAAAGCCCTACCGACAAACCGCCTTTGTCGCCTCT
AGCAAACCTACAGCCACTGCTGGCAACATCCAAAAAACAACTAAAATTAAGTATGACGACGGAGCTGCAGAAAAGAGTTAATCCCACGACAAAAGAAAGC
CCTACGACGATATGGACAGGAAAGCCATTCGCTTTCCCTGCTGTTGTTTCAGTTCCTTCCATCCCAAGTTACAAAAACTAAATATGGTACAGGGAGAGAG
CAAAAGAAAAGCATGCACTATTTGCCCGCCTAATGCTACTACTGGTGCCTGCTGCTGCTACCTGTTTCCTATGTCTTTCCAGGGGTGGTCGGCGTCCTTG
CCCAGGAACTTCGAGCTCGAGCCGTACTGCGCCTTGAGGGCCGCCACCGGGTCCGACACGGGGCTCACGAGGATCCCAGCACCCCCGAGCCGCGCGGCTT
TCCCGGGCTGCTGCTGCTGGAACCCTGAGATGAGCTCTATTCCGTTCCTCTTCTGCAGATCGGCATAGCTTTCCAGCCGCTTCGGATCTGATGGAAGCTG
CTGCCGCAAAGGCTGTTGGTACTCTCCAAATACGCCCAGTGTGCCATTTTTAGCCGAGTAAAATGGCACGCTGGCCATTGATGATCTCTGGCATTTTGCC
ACCCTGAACAAAGATGACTCGGGCTGTGCTGTGCTCCCGTCCAGGTGAGTGTAGCTCCTCACCACTCGCTCGTCCTGCCCAAAGTGGGCAGTATTTGTGG
GCCTAGATGAATAAACCATGCGATCCATTCCGCTGCCCAACAATCCTGCTGCTGTCGTTGGCGGGGGAGGCTTGCTTCTCGTTACATTCGATGATGAGCC
AGAACTTTGCAAGGATGATTGATGGCTCAGAATTTTCCCAAATAACTTGACATCACCAGGGCGCTTCACCTGATCACAACTCTCAGTGCTTGCCTTGTGG
GAACAGGGCTTCAACTGGCCTTCCCGTAATTCTTTGCTGCTCCCATTCATCAGAAACCCAGCAGATGTGCTTGAGAGACCAGAGCTGCCCGACCTGCCAT
TCTGGTATTTCGTTATTGTGAACTGATCCGGATGAGAAATTCCCACACTGCCACTTACAGTGCTATCAGAAAAAGCAGGTATATCAACTGCCAGATGATG
ATTCCGTCTGTGCTGGAAGTATCCATCAATATTGCGGAACAGAACATCATGCTGGCTCCGAGATTGTTCATTAAATACTGGGAACTTGTTCATGTCCTTG
GGCCCTGGAGTATTGCTGACTCTGTTGGCATGATCACCAAAATTTGGTGAAGTTATGGAGGCTATGCCCTCAAAACGAATTGAGGTAGGATCAGGAAGGT
CAGAACTAAACTGAACAGGCATCAAATCCTTTGGAGCAAGAGGGGTAACCTGTGATTTTGGCTTTGCTGGGAGCAGATCTGTTGGCACGCTTTGCTGATA
ACTCGAAGTAAATGCAGGCCTAATACAGGAAACACCGGCCATGTCCGAGAAATGGGTGACATTTTCCTTGCTGCCACTT
page-top