Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16378  (registered. 2012)
Contig Information
Length 933 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VWD Shoot grown with dessication 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108925853|gb|ABG23314.1|| vacuolar proton-ATPase C subunit [Triticum aestivum]
Score 427
Evalue 9.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16378
TTTTTTTTTTACCCAGCTTATTCACCTTGATTTTATTATTATAGATTCTGGTTACTCAAAATTACAATAATGTACCCATTAATACAACACTGCACAAAAA
GTAAACAGTTGTAACAGCGTAGCTGAACAAAAAAAAGAGAAGTCCCACTTTGTGCCAGGATACGTTCGAGGTTCTCCGAAACACTACATTATTGATCGGC
GCGGATCATCTGCTACAGAAGTATAAACCGAAACCGACATTACCATGAAAGAATTGGTGTCACAAAATAATATACATCGAACACCCTCAGACAAAGTTTA
TGGTGAAGGAGACGTAAGGGTGGGACTCTGCCTCGCCTCCCAGGCCAGCAGCCATGCCCACGTCGTCTTCGGATCTCCAGTAGCTGCTGTTGGCGTTGCC
GCATAGCCCTTCCAAGATGTTCCTTACTTTCTTCTCGCTCTTTGTAGATGGTGCTAGGACAACAGACAGGAACCGTGCAGGCAGACCATATCTCAGAATA
CTCTCTACGAAGACGCGAACAGCAGAGAAATGCATCCAGGAGCTAAATACCTCACTGTAGCTTGCATAGCACCATTGCAATAGAGAGGTCCTCATAACTT
CCTGGTCTTGCAGCAGCTTTTCTAGCTCTTGCTTCCGACTCTCCTGTGCTTCAGGACTATACTCAAAGTCACGGATCTGGAAACCTTTCTCACGAGCATG
GACCTTAAAGTTGTCAACAACCTTGGCAAATAATGTTACAGTGTAGAGAGCATACTCATTGTCCTCGTAAAGCTTTTTTGACGATCTCGGAACCACAAAC
GTATCAAGTGACTCGTAGCTTGATAACCAGTCTTTTTGGGAATACTTTGGCACAATAGAAAGCAGTGTCACTAGATGTTCCGAGGTGACCATATCCTCTG
GTTTTATGAGGTTGGAAAGGTCACGAACTGCTA
page-top