Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16348  (registered. 2012)
Contig Information
Length 1799 bp
Clones alternative view 89 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 33
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194706902|gb|ACF87535.1|| unknown [Zea mays]
Score 767
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16348
TTTTTTTTTTAAACAGGGCATGAAGGGCTCAGTCTATTGATTAAAGCAGAAGAGAATTGTCCGGTTAATTAGCGGAAAACCGAGCAAAACCTGTTACAAC
ACACCTAAACCGCCATCATGAGACATGGCCATGCATAGGGCACTGCCGACCACTCTTGTAGGTACATAAGGTACTACATGATGTATATGTAATAAACCAC
TATAGTTACATCCAACATTTATTTACATAGGATAACTCGACATTTCCACTATCTGTTTACGGCTCATTGCAGAGCACGCGATCCTGTACTGTTGAGCTCG
TTCTGAACATAGATGCCATTGTTCTTCAGGAAGCCAGAGTACCAGCGAGCAGAGAGCTTGGCTTGTCGTGGCCGCGCCTCATCGCTAAAATCAACACGGT
ATAGGCCGTACCGTGACTTGGGCCCTGCAAAGAACTCGAAGACGTCTAGGAAGGACCACACAAAGTAGCCTTTTACGTTTGCTCCATTCCTTACTGCCCT
CAGTGTGCTACCCATGTAGCTCTTCAAGTATTCGATCCTTTCGGTGTCATCGAGAGTGTCATTAGATGCAACACCATTCTCTTGCACATAGATAGGAAGG
TTCCCATAGGCTTTCGTAAGGTACTGCAACACATATTGCAATCCTTCCGGGTCACTTTGAGAAGATGATGGGACATTCTTGCTACTTCCTGGGATTGTTT
TAGAAGCTCTTTGGTAAAGAGACATGTCTGCTGAATAGTCGCGAGTGCCTTTGTCTAAAGGACGATCATTAACATACATGGAATAGTAGTGGTTTATTCC
TATGAAATCAACAGTTCCCTTGACAACTTGAGATTGAGATTTTGTAAAGGATGGAAGTCGAGACCCAACATTTTTCTTCATCACATCTGGGTAATCTCCA
GACACCAGGGGCTCTAGTATCCATCCGAACACGAAGTCTAAGTATCTTTTAGCTGCTTCTACATCCACATCAGAGTTCGTCATAGGATAACTCCAAGAAG
AGTAAACATTTATGCCAACACCTCCCTTTTGGGCAGCTTGATATTTTTCTCGGTAAAGTCTGGTAGCTGATGCATGAGCCAGTATCATGTTATGAGCTGC
TATGTATGGTTCCACAGTTGAGTTTCCCACTGTACAATTTGTTATTCCAAATGGGTTGGAGCAACGTCCGGGTGCAAATAGTGCATTGTCGTAAGACCCT
AGTGCGCTGACATTAGGTTCATCTATCGTTGTCCAGTATGAAACCCTGTCTCCGAACTCCCTAAAGCACACGTCCGCAAATGCTGTGAAATCTTCCACAA
TTTTAGGGCTTAACCATCCGGCATACTCATCGTCCAAAACTTGCGGGAAATCGAGATGGGAAAGCATAACATGGACTTGAATCCCATGTTGCACTAGCTC
ATTTATAAGGTTGTTGTAGTACTCCAAGCCTTTTGGGTTGACAGCTCCCCTCCCATTTGGTATAAGCCTTGACCAGGAGATAGAGAATCTGTAAGCCTCT
AGGTTAGTGTCAACCATGAGCTTGACATCATCCTTGTACTTGTGGTACCCATCCGCAGCGACATCGCCTGTGCTTTTATCCGACATTTTCCCTGCTTGAG
TGAAGGTGTCCCAGACGCTTGGGCTCCTGCCATCCTCAGCAACGGCACCCTCATACTGGTATGCGGAGGTGGCGGCCCCGAAGACGAACTCCGGCGGGAA
GTCGCTCCTCGTGAAGCCAAGAACAGGAGGAGAACAAGCGAGGAGCAACATCAGGGAGAAGGCGGCAATGGCAGCCATTGCTGCTGCAACCAGATCGAT
page-top