Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16319  (registered. 2012)
Contig Information
Length 929 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VWD Shoot grown with dessication 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657855|gb|AAB18207.1|| cold acclimation protein WCOR413 [Triticum aestivum]
Score 426
Evalue 2.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16319
GCGAGTGATTAACTGAGAGAGAGGTTTGGGAGGTCTCGCGCGCTAGCCCATGGCAAAGTCGTTCCTCGCGATGAAGACGGGCCCGGCGGCCGGCGCGTCG
GAGGCGTCGCAGGCGCTGCTGGAGTCGGACCTGCGGGAGCTGACCATGGCGGCGCGGAAGCTCGCCAACCACGCCATCGTCCTCGGCGGCGGCATCGGCT
TCATCGGCACTTTCCTCCAGTGGCTCGCCTTCGCCGCCGCCGTATATCTGTTGGTGCTGGACAAGACGAACTGGAAGACCAACATGCTGACGGGCCTCTT
GGTCCCTTACATTTTCTTCACCATGCCCGGTCTGCTCTTCGGCTTCATAAGGGGAGAGATTGGTGCTTGGATTGCGTTCGTTGTTGTCGTCCTGCGGCTG
TTCTTTCCACGCCACTTCCCTGATTGGCTGGAGCTGCCTGGCTCTCTGATCCTCCTCACGGTGGTCGCCCCCGCCATCTTCGCGGACACCTTCAGGGGCT
CCTGGCTCATCATCGGCGTCGGCGTGTGCCTGGTCATCGGGTGCTACCTGCTCCACGAGCACATCAAGGCGTCGGGGGGCCTCAAGGAGGCCTTCCAGAA
GCCCAATGGCTGGTCCAACACCATCGGCATCCTCCTCCTCTTCATCTACCCGGTCTGGGCCGTCGTCATGTGGTTCCTGTAGACCGTTCGCCGCTGTTTT
GGGGTTCGTCGTGTGATGTTTTCTCCGGTGATTTGGTGTCGATCGATGGACCGTGCGCGGTTGTACCTGTTGATTGACGGACTGTTTTGGCCATGTTTTG
ATTTGGTGTCACGTCTTAGTTTGTTTCCTGGATCTGTGGGTACATAGCCATCAATAAAAACGTCTGCTCTGTTGATCGGTGGGTGCATTGAAGTGATGAG
CTGCTTGCCAAGTTCTCTCAAAAAAAAAA
page-top