Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16298  (registered. 2012)
Contig Information
Length 1451 bp
Clones alternative view 326 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_SH - 4
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 22
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 10
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 65
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 14
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 61
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XE Seedling, infected with leaf rust 21
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 68
WH_XV Leaves, plant was grown at constant 23Ž 12
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 7
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_R/WH_SD 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|47847750|dbj|BAD21528.1|| putative brown planthopper-induced resistance protein 1 [Oryza sativa
Score 292
Evalue 6.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16298
CTGTTGTACTGCTTCTGGAAACCGTATGCTATACCATCATTGTCTATGAACACGCGTGGCTGCACCTAATTAAATTTCATGATCAATTTAGGCAAGTCCT
TTTTTAAAGCATATTGCCTCCATTCTTCTGAAACATTATTATGATTTTTAGTTAATCTTACTGTGGAATGTTTTTTTTTTTGCTCATGGAAACATTTTTC
ATGCGCAGATACCAGATACGGTACATAACAGAGCAGAAGCTTCCGGGCGTGCTTCTTTACAAGGAAAAGCTCTCCTAAAAGTTCCCAGGCTTATTTTTGC
GATACAGGCTACTACACTTTTACAGACTATAGATCTGCCTGCTACTCAAAAGTACCGCGGACACACATATTTACAAAATCCACAAGTACCGGGCATGGAC
TCCTGCATCACTAAAACTTCAGCATGGCCTCCAACGCGCGAAGAACGTCATCGCGGGTAACTATACCTATTACTTGATTGTCCTGGTTTACTATCGGTAA
TCTGTGGATCTTCTTCCTGAGCATCAGAGCTGCGGCATCGGTCACTGTTTTATCGCATGATAGCGTGATTGCTGGAGATGTCATCACATCTGCAATCTTC
GTCTTCGACCCATGTGAAGCCCTCACACGATCGCTCTTGACGACGACCCCGATGCATCTGCGAGCGCTGTCGACAACCGGGAGGCCTGACACGAGCTGAA
AGTGGCCTTCAACCTCCACCAGCGCCTGCTCCGCTGTGACCATCAGCACGGGCGTCGACATGGCCTCGCGCAGGAGCGGCCCCCGCTGCTGATCGCCGGC
ATGGGAAGGTGGTTGTTGTTGCTGCTGCTGCTGGGACTGGAGGTACGCGCGGAGGTCGTCGTAGCTGAGGAGGGAGAAGTTCTCGGGCCACTCCCCGGAG
ATGATGGCGTCGGGGTTCTCGTCGAGCCCGAGCCGGAGCCCGCTGCCGTCCATGAACGTGGACGCCCGGCACCCAAAGCTCCCGCCACTGGCTCTACCTC
TTCTGGCTTCAGTCTTGGCCCCTTTGAACATGGAGCAGCTCTGCAAGGTATTGATGCAGGCCATGGATGCTAGCTGTTCTTCACCGCTTACTGCTTCCTT
CCTCGTGCCGAATTCGGCACGAGGATTTGATGGTAGCTTGGAGGATTAGAAATATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCGACTTC
CTCAGTCTTAGTAATTAGTGTACCCCTTGTATTTGCTTCTCCTGATGGTTGGTCAAATAATAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGA
CTAGTCTTTCTCGTAGCTATTCTGAATTCTCTCATTTCTTAAATTAAATTTGGTTAATATTTATTAACCCCATAAAAAAGAAATAATAAAGGCCATTTCT
TCTAAAAAATTAGAATAGTGAGACGTATTAAAACGCAATTTGCGTTCCGAA
page-top