Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16288  (registered. 2012)
Contig Information
Length 748 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195619564|gb|ACG31612.1|| zinc finger protein 511 [Zea mays]
Score 300
Evalue 1.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16288
TTTTTTTTTTCTTGGCAACCCAACAAAAAACATCGATCATATTGATCATGATACAAATATAGTGCAAACTTCAAACGTCCAAGTACAAGGGAAATCCGTA
TTAGAGATTGATAATCCATTGAAGAATTGTCAATTTGCTTCTGGCTGAGAGACCTGCTTGTTCTGCCTAATAGATCTTGGGACAAAAGTAAGACCACGAG
CACGGCGATGGCCAAAGGTTATGCTCGAAGGCACCGAATCTGCAGTGCTCAGCCTTGATACAGCCGAGGACAGTTCATCAATCTTCTGTTCGACCTCCAT
GTCGCTCTCCTTGGCCTCCTTCTCATGATGCTCATTGTCTTTCGACTCCTTGTGACCATGTTCATTTTCTTTCGGCTCCTTATGATCACGTTGCTTCGGC
CGATATCTCGGTTTCGATTGCCTTGGATTCTTCCCATCAACGTCCATGACAGTATCCCTTGTCTCTTCTCCCTTATAAGCAGTTTGCCTTCGATGATGAT
ACTTCTGACGATGCCGCTGGGAAGGTTGTGCTCTTTTGAAGAATTCAAATGAGTTGGGAAATTGATGCTTATCAACAAGATGCTGCTGCCGACTTTTGTA
CGTCTTCAACTTCTCCCCACAACCCTCCACCAAACATTCGTACATCGGAAAACCACGAGCGACTTTTGCTTGGAAGAAGGAATCATGCGCCTCAGAAATA
TGAATACTCAGCAACCTTGATGTTGGGTACACTCTTGAACCCTCGTGC
page-top