Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16229  (registered. 2012)
Contig Information
Length 1113 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238477377|gb|ACR43489.1|| UDP-glucosyl transferase [Triticum aestivum]
Score 492
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16229
AAATATGAAACCTGCGCAACAGAATAGATAGTGATCCTGATACAAGCTACTGGTTATTTGTAAAAGAAATCCTTTATAACGATAAATATGCTATAGGCTC
TTTTACTTTTTGTTTACACCAAAAAAGAGAGCTTATTACCATCTCTATCAACCACTGAACCACATGCATTCGTCTTGATTTCCATTTCTTGAATTAATAG
CCTTATGTTGTCATACGAAGAACCTCCCTCATCGAAAGCCCTCCTTGCCTTAATGGCGCAGTCTTTTGCTCTCACCCTCATCTCTTCTGCAGCCGCGCCC
TCATCCATCAGGGTGTTCACAGCTTTCTGCACCTCATCTCTTGTGACCATAACCTCCTGGTTTTCACTTCCCCACTGTGTAACTCCTTTCACTCCAACCT
CCATCCCGATTTTCAGCACATCCACCAGCAGCTTCTCATTCAAAAACTGCTCCCCAAAGTGCGGCCATGTGATCATGGGCACACCTGCACAGATGCCCTC
TATTGTTGAGTTCCACCCGCAGTGCGTCACGAATCCTCCAACGGCTTGGTGCTGCAGGATCATGAGCTGTGGCGCCCAACCCCTTATGACCATGCCTCTA
TTTTTGACACGCTCCTCGAACTCGTCTGCGAGCCATTCCTCGACTTCTGGAAGCTTAGCTCCTGCTTTGATCACCCAAATAAACGGTTTCCTGGAGGTTT
CAAGTCCCAGTCCCAGCTCAACAAGCTGTTGAGGTGTAGTGCAAGCGAGGCTGCCAAAGCTGACAAAGACCACTGAGCCTGGCTTCATTGAATCAAGCCA
TTGCAAGCACTGTGCTTCATCCATTGACACCTTGTTTCCTCTTGCGGGCCATAGTGTTGTTGTCTCGGTGGCAGAGGCACATTGGTCCGACCGCCCAGAC
CTTCTTCTTTGTCGTCTGCTCAAAGGATTCAATGTACAATGTCTCCAGCTCCTGGAAGCTGTTAATTACCTCACCATCACTTTTCAGCTCCTCTTCAAGG
AACTTCTTACGGATTTGCTTCATACCAGGAATACAAAAATTTCCAGGGCATTTTGCCTTTGTCAGCTCTAGTGGCGTAGGGAACCCTGTGATTGTGATGA
GCTCATTTTCGTC
page-top