Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16223  (registered. 2012)
Contig Information
Length 909 bp
Clones alternative view 110 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_SP 2
WH_XA Root 5
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|137476|sp|P23957.1|VATL_AVESA|VATL_AVESA RecName: Full=V-type proton ATPase 16 kDa proteolipid subunit;
Score 317
Evalue 2.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16223
AGAAAAGAGATGAACATAATATAATCATAAATTTATTATTTAGCTACAATGCGTGTTTTTATTCACCACCAGTAGGATTAAAACCCATATAACCAGGAGC
AGCAATCCAGCCTACCCCAAAATCCTCTGCACGAACAGCAAACGCCCACCACAACCCAAAAAGAACGAAAACGGTACTGGAAGTGTCACCTTCCTTAATA
ATCTACAAATATCTCCTTAATACATCAAAATTAGAACTTTTCAATGCTTCAGCTTCTCAAGAATGTAGCCTGTGTGGCAATTGCAGAATGGTAGAGCGAG
GCGCCTAATCCGCACGGGACTGGCCGGCACGGGACGACAGGATGATGCCCACGATGAGACCGTAAAGGGCAAGTGCTTCTGCGAAAATGAGGATAAGGAT
CATACCCACGAACAGCTTTGGTTGTTGCGCGTTAGCCCTGACTCCAGCATCACCGACAATGCCAATGGCCATGCCGGCGGCGAGCCCCGCGAGGCCACAG
GCGAGCCCGGAGGAGAGGTGAGCGTAGCCGTCGAAGAGGAAGTAGGGCTTGGCCTTGGGGTTGATCCCGGTGCTGATGATGACGGCGATGATGAGGCCGT
AGATTCCGAGCACACCCGCCATGACGACGGGCACGATGGACTTCATGACGAGCTCTGGCCGCATGACCCCCATGGACGCCACCCCGACCCCGCTCTTGGC
CGTCCCGTAGGCCGCCCCCATGCATGAGAAGACGAGCGCGGCGGCGGCGCCGAGGAAGCCGAAGAAGGGCGCCGTCTCATCGCCGCTGAACACCGACGAC
ATCTTGCTCCTCTTCTTCCTCCTCCGGTCGCGCTTCTTTCCTGTGGAACTCGGGGTGGCCTCGTCGCTAAGGAAGATGGTTGGTAGGGAGAGGAACAGAG
GGCCTCTCC
page-top