Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16215  (registered. 2012)
Contig Information
Length 894 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222624657|gb|EEE58789.1|| hypothetical protein OsJ_10324 [Oryza sativa Japonica Group]
Score 404
Evalue 9.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16215
TTTTTTTTTTGAAAGAACATCAGCTCAGATTATGTATTCAACTATAACCAACCCGTAGATGCCGCATTTGGTTCCAAACAAATAGAATTACATATATATA
TAAGAGACCAAAAGGTTTGATCCAGAGACAGAGGACACAACAACTGATGCTGGACACAGCCCCGAGGAGTAAGATCACAAATACAGAACAAAATTCACAG
CAACTGTAAGGATGAACAAAGAATAGCTCAGTAAGTGGGGTAGTAATACCCTGTATTCGCCATTGGCGCGTTTGGCATCCCGTATGGCATGGCTGGGTTT
GGGCCGAAGCCATTGTTGTAGGTCCGATCGAGCTTGGCCAAGCTCGACGGCCCCTGCATGCCGTCCCGTTGGTACTGCTGCCACATCATCTGCTCCTGTG
TCAAGAACTGCTGCTTCTTCTCCATCTCGGCCATCTGCACATAGGATGGTGGTGCAAAGGTAAGGGATGCCGCAAAAGGATCCCCACCAACGTTCTGCAT
CGAACCGTCTGGTGCCGGAAGAGCCAGCATCTGTGTCTTCTGTCCAGGCGCAGGTAGGGCAACACTGCTGGAGCTCCCACTAGTCGCCTGTGCGTTGACA
TGCTGACGCACAACACCTTGGTCGTACATACCATTCAGTAGCAGATTATCCATACCACCTGTCATTACAGCCTTCTGCTTGGACAAGTTGCTAGCCGTCT
CCACAAGGGCAAGTTCCCAATCAGCCTTACCGGGCTCAGCCGCAGGATTCTGCCATGCAGAAGTCACTTCGTTGCCACCATTGGAAGGNNNNNNCTCCCA
TGACCCATTGCTACCACCAGCAGCAGGTGGCCCTTGGAAGNNNGCCAGAGCAAGCCTATTGCCTTGCTCATCTGCACTCACAGTGTCTTCTCTA
page-top