Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16204  (registered. 2012)
Contig Information
Length 638 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2827002|gb|AAB99745.1|| HSP70 [Triticum aestivum]
Score 139
Evalue 2.00E-31
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16204
TTTTTTTTTTGAAGGAGCCAAGGGATGTTTATTGCTGGAAAGTTATAGAGACCATTACATGCTCACAGAAGAGCAGGTAAGTATGAGTACAACATCATTC
CCTCTGGATTATTTTTATTTTTATTTTTACTTCCGATGAACAAGCCTGGGCATCCTTTTTCAGCGTGCCGACGGCGGTGGAGCGGGCGGGCAGCAGTTGT
CGCCGCAGCAGGCGTGGCCGCAGGTCCTCGTCGGATGCTCCACGATCCAGCAGCACTGGCACGGCAGTGAAGCAGTGGTGGTTGTGATGAAGAGCGCAAG
CAGAAGCAGCATGAGCCAGGACGCCAGGGCAAGGAGAGTGTTCCTCCTCATGCCTCCTGTTTTGTTTGCTGTGTTCCCCTCTTGATATGCTTCACGGTTC
AGAGCTTTCAGGGGAATTCGGCACGAGGGTGGCCCTTCAAGGTCATCCCTGGCCCTGCAGACAAGCCCATGATCGTCGTCAACTACAAGGGTGAGGAGAA
GCAGTTCGCAGCGGAGGAGATCTCCTCCATGGTGCTTATCAAGATGAGGGAGATCGCTGAGGCCTTCCTCGGCAACTCTGTCAAGAACGCCGTGGTCACC
GTTCCGGCCTACTTCAACGACTCCCAGCGCCAGGCCAC
page-top