Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16196  (registered. 2012)
Contig Information
Length 929 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625603|gb|EEE59735.1|| hypothetical protein OsJ_12188 [Oryza sativa Japonica Group]
Score 287
Evalue 1.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16196
CTCCATTATTTTTCGTCTCATGTGAGGTCATGTGAGGGTATGGGTTACACTTACACAACGCCTCCGGTGCTCAACATTCCACACCATCGCAAGCAGCTCG
CGTTCACCACAGGTCCTCCTCATGTTCCAGGTGCGCCCGACCGAACCTATTTCTCGTCGAGGCGGCGCATCGAAACCTACCATTCCACGGGCAAATTAGC
CATATTTACTAGCTCCAGAATCACGGGCAGCAACAACAGCAGCAGAGGCAGTCAGAGCTCATGTAACGATATACAGATTTTACATGCAGCCGCTCGCGCT
AGCTTCTCACGGCGGTGAACCGACGAGGAGAGTCCGCCTCCGGTTTCCTGGCCGGAAACCTCGAGGGGCCTCGCCGCCGCGCCTTGGCATGATCAGGCCA
CCTCCCAGATCCCAAACAAACAATGGTTAGCTGGTCCTTGCAAGTCACCAAGTTCAGGCACCGTTTGTCATCAGTGGCTGATACTTTGCATAATCTATCC
CGTTCAACCTAACACAGCACAAGACCTGCTCAGGCAATTCTTCGGGTTTGTTTCCCTGGATGGTTAGCCCAACATCTAGCATGCATATTTTTAGCCTGTC
CAGGAATGTCTCGAAACCTTTCCTTGAGATGTAGCCAAATCTATGCATGTCAATGTCAACCTCAAAGTAGTTATCACCCAGGAAAAACTGATGCTGAGGT
CTAGAAAGCACAGGCTTCTCGTTGTATGCATGCATTAGCTTCCTCTCCGCGGCACTTAAAGGAAGGTCCTCCAGATTAGCCACCCGTCCAAGTATCTTCA
GCCGTTCCCGAAATGATATACTTGTTTCCATAGGAAATCCTTTTATTTTTTCTACATCATCATCAACCAACCTTCTGATATTCTCTATGAATAAGGGTGA
AAGCTCTTTTGAGTAACCTTCGGAAAGCC
page-top