Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1619  (registered. 2012)
Contig Information
Length 1558 bp
Clones alternative view 69 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 5
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 8
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XB Root 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1619
CAGGAATTCGGCACGAGGGGAAACCTAGCCGCGTTCTCCTCTGCGGCACGCAACCTTTGTCCCCCTCTAGATATAGAACAACACGCCTCGTCCACCCATA
CCTCTACAAGTCAGATCTAGGCCTGACCTGTAGTTTCCTGACCGTGCTCGCCTCGATCTCGGGGTAAGCTGAATTCGGCGTCCATGATTTGTTCCGATCA
CCCGTTTGTTATCTGATTCCCAGGTTTGTCCTTCTGATCGGCGAGTTGGGGCTTGCGGCGATCTTGGAGAAAAGACGGGAGGCAAGCTGGATCTGCCCAC
GGAAGCTTCCGATCTGCCCGGCTGGCGTCTCAGATCTGTTGCTGTTCTGATGCTTCACGGCGGATCTGGTTTTTCCCGGCGGTCTCAAGTCGGCGCAGCG
GCTGGCGGCGAGTTTTCCGGCAAGCACGTGGGATCCCGTCTGCTCCTCTACCTCGTGCGACGACGGCCGACGGCTCTTTGTGTTGATAATTATTCGATGA
TATGTCGGTAATTATTAGATCCAAGAGATCGGAGGTGATGAAAGGTAAGAAGATGTAACAAGCGAGGTGCTTGTGGAGAGGGCGGAGAAGAGCGGAAAAA
AAAGAGATGTGAACATCTAGAGGCCTTTGCCATGTTGGGTGCGCTCGCATGGCAGGCCGCCACCATAATAAAGATGTTTTTTTTGTCTCGGGGGGAGATC
GCACGGGGGTTATCTTGTTTTAGCCCCGGGTTCTCCCCCCTGTGTGCTGGTGTGCTCCTTTTGTCTGCACCTCTCGTCCGATCCGACTACATGGCACAAC
AATTCTACCGTCGCGAATCGATCATGGAGCTACAGACGAAAGAACAAAGGTACAATCGATAATTTACATACAGCTGAACCATATATAATCATTGACACCA
CAAATTTCAATACATACAAGGATTATCTTGAATCCATACAAGTAACTTTGGTAGATATAGATATAGAGATTGTGTTGACACATCACCACAAATCTGCAAC
CAACTACAGCAGTCCAGCCTAAACAAATTGTTTGCATGCGGATTTACATATTGTTGTAACAATTCGAGTATATTTGGATTCTTCACTCAGAAGTTGTGTT
TATTTGTATGATATTCTGTACTAAATTTAAGTTTAATTCTCCCTATATAAGGATTTTTTAATAAGAAATTCATATTAGACCCCTTTTCTCTGGTCTCCTG
CTTCATATTGTAATCTGTCTTACGTAAGATACAATTTATGTAGCTTGAACAGCTGTATGTGGGTCTTTGTATTACCCAAATGAAGCCTACAGCTATACGC
AGGTGGACACATCTTTCTCGTTGGAGCTTGAAGAGACGTGAGAGCTCTATGATTCTGGAGAAATCTGCCGAACACATCTTACCTCAGGGAATACCCGCTG
GGAGGCTGGTTTACATGTACTTGCTTACTAATCTGGATAATCATTTATTAGAGCGCTATTTTAATCAGTTTCGCTACATATTATGGTGAACATTACATCC
ATTTGTATCAGTTGGTTAAAGATAATTAGATATTTATTATATTTGTGGATATTCTCCT
page-top