Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16160  (registered. 2012)
Contig Information
Length 972 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_SH - 8
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 8
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|445116|prf||1908421A|1908421A light-harvesting complex IIa protein
Score 462
Evalue 2.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16160
TTTTGCGTGGATTTTTTTTTTGTAATCGCAAAAACGAAACAAAAGATTAGCTCAAGATTGATGTACAAGTGGATGCATTAAGTCACCATTGGTTCATATT
TTACAAATCACCAAGTCCCAGCAGCTCTCCTATGTGATCAGACCTGCATTAATCAACAAAGGATCTTTGCGATACCCTCTCATCCATCACTCGTCATACA
AAACCAAAGCACGTTCGTACACTGACGCGCGTTCGTCCATTTTGCAGCTGAGCTGACAGAAATTGCTCGACCACCGACCACTTAAGAGGAGCCGAAGGTG
TCGAAGATGGTGGTGTGCAGCGGGTCGCTGAGGTGGGTGGCCCAGTTGTTGAGTGGCCCCTTGCCGGTGGCGGCGGCCTGCACGGCGAAGCCGAGGAAGG
CGACCATGGCGAGGCGGGCGTGCTTGATCTCCGCCAGCTGCAGAGTCTCCTTCTTCACCGGGTCCGCCGCGAGTCCCAGCGGGTCGAAGTAGGAGCCACC
GGGGTAGAGCCTCCTCTCCGGGTCCAGCTCCGCGTTGCGCTGGAACTCGATGTACCCGATCACCAGCACCTCGATCCAGATCAACGTGGTGAGCGTGAAC
GGCAGCGGCTGCCCCAGGTACGACGACCCGTCCACCAGCTCCACCTTGCCGGCGTCCTGCCAGGTGACGCCGGTGAGCCACTCGACGGTGAGGGCGCCGA
GGGTGGCGAGCATGGCCCAGCGGCCGTGGATGAGCTCGCACTCGCGGAACCTCTGGAGGCCGAACACCTCGGCGTAGGGCTGGAACGGGGTGGACTTGAC
GTCGGCGTCCTCGAACCGGGTGCCGATGATCTCGCCCGCCAGGTTCTGGGCCAGGTTCTGGTCCAGGGAGTCCACGTCGTACTGCAGGTACTCCGCGGGC
TTCCCGAGGCCGAAGGGGTCGAAGCCGTAGTCGCCGACGAGCGTGCCGTCGAGGTACTCGGGCGCCTGCGCG
page-top