Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16148  (registered. 2012)
Contig Information
Length 1524 bp
Clones alternative view 339 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 111
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 37
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XE Seedling, infected with leaf rust 28
WH_XF Seedling, infected with leaf rust 44
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 21
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 17
WH_XV Leaves, plant was grown at constant 23 20
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 12
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 18
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|311764|emb|CAA80493.1|| (1,3;1,4) beta glucanase [Triticum aestivum]"
Score 668
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16148
CCTCGGATCCTATATAAGGGGCCGGCGCCCCGTTGTGGCCTCACCAGAAAAGAAACAACAAGAGCTTTAGAGCGAGAGAAAGAAAGACACATACACACAC
CCACACACCCTCAACGCAGCTAGAGAGACAAAGAGAATGGCGAGCCAAGGTGTTGCCTCCATGTTCGCTCTGGCATTGCTCCTCGGAGCCTTCGCCTCCA
TCCCACAAAGCGTCGAGTCCATCGGGGTGTGCTACGGCATGAGCGCCAACAACCTGCCGGCGGCGAGCACCGTCGTCAGCATGTTCAAGTCCAACGGCAT
CAACTCCATGCGGCTGTACGCTCCCGACCAGGCGGCGCTGCAGGCCGTCGGCGGCACGGGCGTCAACGTCGTCGTCGGGGCGCCTAACGACGTGCTCTCC
AACCTCGCCGCCAGCCCAGCTGCGGCCGCCTCGTGGGTCAGGAGCAACATCCAGGCCTACCCCAAGGTCTCCTTCCGGTACGTCTGCGTCGGCAACGAGG
TCGCCGGCGGCGCCACCCAGAACCTCGTCCCGGCCATGAAGAACGTGCAGGGCGCGCTCGCCTCCGCTGGGCTGGGCCACATCAAGGTCACCACGTCGGT
GTCGCAGGCCATTCTCGGCGTGTACAGCCCGCCCTCCGCCGGGTCCTTCACCGGGGAGGCGGACGCGTTCATGGGCCCCGTGGTGCAGTTCCTTGCCCGC
ACCGGCGCGCCGCTCATGGCTAACATCTACCCGTACCTGGCCTGGGCCTACAACCCGAGCGCCATGGACATGAGCTACGCGCTCTTCACCGCATCCGGCA
CCGTGGTCCAGGACGGCTCCTACGGGTACCAGAACCTGTTCGACACCACCGTGGACGCCTTCTACACGGCCATGGCCAAGCACGGCGGCTCCAACGTGAA
GCTCGTGGTGTCGGAGAGCGGGTGGCCCTCAGGCGGCGGCACGGCGGCGACTCCGGCCAACGCCAGGATCTACAACCAGTACCTCATCAACCACGTCGGG
CGCGGCACCCCGCGCCACCCGGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACAGCGGCGTGGAGCAGAACTGGGGACTCT
TCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTCTGATGAGCTAGCTGCGTATGCGTAGCTAGTGTCCGTATGTCCGTACGTACGCGCGCGTACAC
GCGTATAAGAGCGTGTATGCGGTACGTATGTGCACATTATGTATTGTACAGGGTTTGGGTTGGGGTGCGACCGCTGAGGCAGCTCAGATGCGTACGCTAT
AGTAGTGGTTTGCTGTAGTAGTGTATGTGTATGATTTACGATGGAAGGGAAGCAGATGTAAACGCTCTCCCTTCGTCGATTCATCATACATTTGATACGT
ACACACATGTGTGCGTAAGTAGAACTATATTGTAGGGTTCAAAATTTCGTCAAAATTTGACGGAATTTGTCCAAAATAATATGAAATATATCGGCGAGAC
CGAAGTATTCCTATAAAAAAAAAA
page-top